Incidental Mutation 'R7086:Arfgef2'
ID549881
Institutional Source Beutler Lab
Gene Symbol Arfgef2
Ensembl Gene ENSMUSG00000074582
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
SynonymsE230011G24Rik, BIG2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location166805588-166898052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 166876616 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1442 (C1442S)
Ref Sequence ENSEMBL: ENSMUSP00000096677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099078]
Predicted Effect probably damaging
Transcript: ENSMUST00000099078
AA Change: C1442S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096677
Gene: ENSMUSG00000074582
AA Change: C1442S

DomainStartEndE-ValueType
Pfam:DCB 7 200 1.6e-40 PFAM
Pfam:Sec7_N 377 536 3.7e-53 PFAM
Blast:Sec7 549 598 8e-18 BLAST
low complexity region 621 633 N/A INTRINSIC
Sec7 647 834 1.55e-97 SMART
Blast:Sec7 853 888 2e-11 BLAST
Blast:Sec7 902 941 4e-15 BLAST
low complexity region 1044 1055 N/A INTRINSIC
Pfam:DUF1981 1174 1257 6e-38 PFAM
low complexity region 1719 1729 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It contains a Sec7 domain, which may be responsible for its guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exencephaly, midline gut closure defects, periventricular and subependymal heterotopia, and impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Arfgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Arfgef2 APN 2 166885853 missense probably damaging 1.00
IGL01323:Arfgef2 APN 2 166871495 missense probably damaging 1.00
IGL01415:Arfgef2 APN 2 166867355 missense probably damaging 0.98
IGL01638:Arfgef2 APN 2 166873945 missense probably damaging 0.97
IGL02618:Arfgef2 APN 2 166853313 missense probably damaging 1.00
IGL02899:Arfgef2 APN 2 166869051 splice site probably benign
IGL03012:Arfgef2 APN 2 166868888 splice site probably benign
IGL03063:Arfgef2 APN 2 166859782 splice site probably benign
shimmering UTSW 2 166826928 missense probably benign
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0102:Arfgef2 UTSW 2 166845465 missense probably benign 0.00
R0116:Arfgef2 UTSW 2 166873683 missense probably damaging 1.00
R0128:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0130:Arfgef2 UTSW 2 166835719 missense probably damaging 1.00
R0208:Arfgef2 UTSW 2 166867422 missense probably damaging 1.00
R0379:Arfgef2 UTSW 2 166860400 critical splice donor site probably null
R0945:Arfgef2 UTSW 2 166826969 unclassified probably benign
R1226:Arfgef2 UTSW 2 166827640 missense probably damaging 1.00
R1252:Arfgef2 UTSW 2 166859957 missense probably damaging 1.00
R1695:Arfgef2 UTSW 2 166864712 missense probably damaging 0.98
R1696:Arfgef2 UTSW 2 166861638 missense probably damaging 1.00
R1742:Arfgef2 UTSW 2 166866980 missense probably damaging 1.00
R1935:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1936:Arfgef2 UTSW 2 166863603 missense probably benign 0.28
R1939:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R2276:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2279:Arfgef2 UTSW 2 166865759 missense probably benign 0.00
R2349:Arfgef2 UTSW 2 166852028 missense probably damaging 1.00
R2359:Arfgef2 UTSW 2 166860619 missense probably damaging 1.00
R2414:Arfgef2 UTSW 2 166845504 missense probably benign 0.00
R2519:Arfgef2 UTSW 2 166881244 missense probably benign 0.03
R2938:Arfgef2 UTSW 2 166894733 missense probably damaging 1.00
R3696:Arfgef2 UTSW 2 166853300 nonsense probably null
R4022:Arfgef2 UTSW 2 166873945 missense probably benign 0.01
R4227:Arfgef2 UTSW 2 166867324 missense probably damaging 1.00
R4293:Arfgef2 UTSW 2 166890291 missense probably benign
R4455:Arfgef2 UTSW 2 166894715 missense probably benign 0.43
R4499:Arfgef2 UTSW 2 166885814 missense probably damaging 0.99
R4570:Arfgef2 UTSW 2 166856538 missense probably damaging 0.99
R4888:Arfgef2 UTSW 2 166835613 missense probably damaging 1.00
R4893:Arfgef2 UTSW 2 166866956 missense probably benign
R5032:Arfgef2 UTSW 2 166878544 missense probably benign
R5191:Arfgef2 UTSW 2 166876511 missense probably damaging 1.00
R5200:Arfgef2 UTSW 2 166860684 missense probably benign 0.00
R5318:Arfgef2 UTSW 2 166873971 missense probably damaging 1.00
R5378:Arfgef2 UTSW 2 166873628 missense probably damaging 1.00
R5537:Arfgef2 UTSW 2 166856593 splice site probably null
R5866:Arfgef2 UTSW 2 166836257 missense possibly damaging 0.88
R5878:Arfgef2 UTSW 2 166870217 missense probably benign 0.41
R5972:Arfgef2 UTSW 2 166891836 missense probably damaging 1.00
R6147:Arfgef2 UTSW 2 166871495 missense probably damaging 1.00
R6293:Arfgef2 UTSW 2 166873588 missense possibly damaging 0.92
R6323:Arfgef2 UTSW 2 166834484 missense probably damaging 1.00
R6338:Arfgef2 UTSW 2 166845570 missense probably damaging 1.00
R6538:Arfgef2 UTSW 2 166893621 splice site probably null
R6726:Arfgef2 UTSW 2 166893620 critical splice donor site probably null
R7047:Arfgef2 UTSW 2 166851945 splice site probably null
R7108:Arfgef2 UTSW 2 166873608 missense possibly damaging 0.80
R7155:Arfgef2 UTSW 2 166865813 missense probably benign 0.19
R7159:Arfgef2 UTSW 2 166826928 missense probably benign
R7482:Arfgef2 UTSW 2 166851279 critical splice donor site probably null
R7598:Arfgef2 UTSW 2 166856524 missense probably benign
X0040:Arfgef2 UTSW 2 166859883 missense probably damaging 1.00
X0063:Arfgef2 UTSW 2 166891841 missense probably benign 0.32
Z1088:Arfgef2 UTSW 2 166893595 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GAGCAGCCATCTTACCCTAGAG -3'
(R):5'- GTACACACGGATGGACAGACAC -3'

Sequencing Primer
(F):5'- AGCCATCTTACCCTAGAGATGTTGG -3'
(R):5'- AAGTGCATCTCACCCTTTAAAAC -3'
Posted On2019-05-15