Incidental Mutation 'R7086:Adam30'
ID549889
Institutional Source Beutler Lab
Gene Symbol Adam30
Ensembl Gene ENSMUSG00000043468
Gene Namea disintegrin and metallopeptidase domain 30
Synonyms4933424D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98160630-98164169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98161319 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 28 (H28R)
Ref Sequence ENSEMBL: ENSMUSP00000142590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]
Predicted Effect probably damaging
Transcript: ENSMUST00000050342
AA Change: H156R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: H156R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 159 5.7e-20 PFAM
low complexity region 176 187 N/A INTRINSIC
Pfam:Reprolysin 202 393 1.1e-31 PFAM
DISIN 407 482 1.6e-32 SMART
ACR 483 625 1.84e-52 SMART
transmembrane domain 690 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198363
AA Change: H28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: H28R

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:Reprolysin_5 72 259 2.6e-6 PFAM
Pfam:Reprolysin 74 265 2.1e-29 PFAM
Pfam:Reprolysin_3 101 220 1.1e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Adam30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Adam30 APN 3 98162170 missense probably benign 0.01
IGL01630:Adam30 APN 3 98161855 missense possibly damaging 0.83
IGL01825:Adam30 APN 3 98161901 missense probably damaging 0.96
IGL02033:Adam30 APN 3 98161471 missense probably benign 0.13
IGL03157:Adam30 APN 3 98162296 missense possibly damaging 0.85
IGL03330:Adam30 APN 3 98162456 missense probably damaging 1.00
R0512:Adam30 UTSW 3 98162125 missense probably damaging 1.00
R1082:Adam30 UTSW 3 98162290 missense probably benign 0.30
R1173:Adam30 UTSW 3 98162906 missense probably benign 0.07
R1463:Adam30 UTSW 3 98162525 missense probably damaging 1.00
R1771:Adam30 UTSW 3 98161519 missense possibly damaging 0.94
R1862:Adam30 UTSW 3 98162113 nonsense probably null
R3442:Adam30 UTSW 3 98162570 missense probably benign 0.35
R4125:Adam30 UTSW 3 98161363 missense probably damaging 1.00
R4714:Adam30 UTSW 3 98162854 missense probably damaging 1.00
R4816:Adam30 UTSW 3 98162745 missense possibly damaging 0.68
R5447:Adam30 UTSW 3 98161343 missense probably benign 0.09
R5958:Adam30 UTSW 3 98161964 missense probably damaging 1.00
R6175:Adam30 UTSW 3 98162950 missense probably damaging 1.00
R6220:Adam30 UTSW 3 98161309 missense probably damaging 0.98
R6338:Adam30 UTSW 3 98161541 missense probably damaging 1.00
R6365:Adam30 UTSW 3 98161034 missense probably damaging 0.99
R6998:Adam30 UTSW 3 98162710 missense probably benign 0.03
R7290:Adam30 UTSW 3 98162941 missense probably benign 0.00
R7340:Adam30 UTSW 3 98162321 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCACTCAAGAGGGCAGTCTG -3'
(R):5'- ATCCTAGACATATTGCCACGGG -3'

Sequencing Primer
(F):5'- CAGTCTGATAGAGGATTATCCGC -3'
(R):5'- GGGCAAACACGAATCTATCCAGG -3'
Posted On2019-05-15