Incidental Mutation 'R0615:Tprn'
ID54990
Institutional Source Beutler Lab
Gene Symbol Tprn
Ensembl Gene ENSMUSG00000048707
Gene Nametaperin
Synonyms
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25262618-25269885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25264198 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 504 (E504G)
Ref Sequence ENSEMBL: ENSMUSP00000109975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114336]
Predicted Effect probably damaging
Transcript: ENSMUST00000114336
AA Change: E504G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: E504G

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155738
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Tprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03072:Tprn APN 2 25264518 missense probably damaging 1.00
IGL03139:Tprn APN 2 25264054 missense probably benign 0.31
R0568:Tprn UTSW 2 25264321 missense probably damaging 1.00
R0706:Tprn UTSW 2 25264491 missense probably damaging 1.00
R1675:Tprn UTSW 2 25264409 missense probably benign 0.01
R2508:Tprn UTSW 2 25268928 missense possibly damaging 0.95
R4257:Tprn UTSW 2 25264482 missense probably damaging 1.00
R4493:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4494:Tprn UTSW 2 25268892 missense probably damaging 1.00
R4898:Tprn UTSW 2 25268833 missense probably damaging 0.99
R5536:Tprn UTSW 2 25263357 missense probably benign 0.07
R5537:Tprn UTSW 2 25263357 missense probably benign 0.07
R6753:Tprn UTSW 2 25264038 missense probably benign
R7554:Tprn UTSW 2 25263799 missense probably damaging 1.00
X0003:Tprn UTSW 2 25268911 unclassified probably benign
X0010:Tprn UTSW 2 25268911 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGCAATTTCTGACACAGACAAG -3'
(R):5'- GATTTACGGAGAAGACCTCCATGCC -3'

Sequencing Primer
(F):5'- CAGACAAGTGTGTTAGGTGGC -3'
(R):5'- GGACTGACCATTGGTCTGAC -3'
Posted On2013-07-11