Incidental Mutation 'R7086:Kcnip1'
ID549905
Institutional Source Beutler Lab
Gene Symbol Kcnip1
Ensembl Gene ENSMUSG00000053519
Gene NameKv channel-interacting protein 1
Synonyms3202002F18Rik, 2900046L02Rik, KCHIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33629339-33993152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33634629 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 175 (P175T)
Ref Sequence ENSEMBL: ENSMUSP00000104964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065970] [ENSMUST00000101368] [ENSMUST00000109340]
Predicted Effect probably damaging
Transcript: ENSMUST00000065970
AA Change: P164T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069063
Gene: ENSMUSG00000053519
AA Change: P164T

DomainStartEndE-ValueType
EFh 90 118 2.24e1 SMART
EFh 126 154 8.77e-7 SMART
EFh 174 202 2.83e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101368
AA Change: P136T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098919
Gene: ENSMUSG00000053519
AA Change: P136T

DomainStartEndE-ValueType
EFh 62 90 2.24e1 SMART
EFh 98 126 8.77e-7 SMART
EFh 146 174 2.83e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109340
AA Change: P175T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104964
Gene: ENSMUSG00000053519
AA Change: P175T

DomainStartEndE-ValueType
EFh 101 129 2.24e1 SMART
EFh 137 165 8.77e-7 SMART
EFh 185 213 2.83e-1 SMART
Meta Mutation Damage Score 0.4027 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increase susceptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Kcnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Kcnip1 APN 11 33643289 splice site probably benign
IGL00597:Kcnip1 APN 11 33643294 critical splice donor site probably null
IGL01064:Kcnip1 APN 11 33633192 missense probably damaging 1.00
IGL01125:Kcnip1 APN 11 33633202 missense probably damaging 1.00
IGL01324:Kcnip1 APN 11 33645603 start codon destroyed probably null 0.01
IGL01409:Kcnip1 APN 11 33630593 missense probably benign 0.00
IGL02622:Kcnip1 APN 11 33643290 splice site probably benign
R0149:Kcnip1 UTSW 11 33843177 missense probably benign
R0319:Kcnip1 UTSW 11 33651529 splice site probably benign
R0361:Kcnip1 UTSW 11 33843177 missense probably benign
R1314:Kcnip1 UTSW 11 33642481 missense probably damaging 1.00
R3420:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3421:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3422:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R4631:Kcnip1 UTSW 11 33992821 exon noncoding transcript
R4843:Kcnip1 UTSW 11 33644504 missense probably benign 0.00
R5007:Kcnip1 UTSW 11 33642495 missense probably benign 0.05
R5337:Kcnip1 UTSW 11 33642389 intron probably benign
R5596:Kcnip1 UTSW 11 33630597 missense probably damaging 1.00
R6058:Kcnip1 UTSW 11 33642478 missense probably damaging 1.00
R6210:Kcnip1 UTSW 11 33645600 missense possibly damaging 0.93
R7363:Kcnip1 UTSW 11 33634589 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGGCCAGACAAACTTGC -3'
(R):5'- GCTTCAAAGGGTCCTCATAACC -3'

Sequencing Primer
(F):5'- CTTGCTCAGTATGTACACAGATGC -3'
(R):5'- TAACCCCTCTGTTTAGCTAGAGGAAC -3'
Posted On2019-05-15