Incidental Mutation 'R0615:Olfr1297'
ID54992
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Nameolfactory receptor 1297
SynonymsGA_x6K02T2Q125-72673494-72672556, MOR248-4
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111615233-111626497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111621919 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 52 (D52N)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000207283] [ENSMUST00000213398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099612
AA Change: D52N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: D52N

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207283
AA Change: D52N
Predicted Effect possibly damaging
Transcript: ENSMUST00000213398
AA Change: D52N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.2311 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R1028:Olfr1297 UTSW 2 111621525 missense probably damaging 1.00
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R1981:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4494:Olfr1297 UTSW 2 111621148 nonsense probably null
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R6730:Olfr1297 UTSW 2 111621735 missense probably damaging 0.96
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R7735:Olfr1297 UTSW 2 111621474 missense probably damaging 1.00
R8017:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8019:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
R8285:Olfr1297 UTSW 2 111622045 missense probably benign 0.32
R8419:Olfr1297 UTSW 2 111621504 missense probably benign 0.10
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Z1176:Olfr1297 UTSW 2 111621261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAGTGCATGTGGACAGAG -3'
(R):5'- ATGGAGACAATCAGACTGTTGTGTCAG -3'

Sequencing Primer
(F):5'- CTAGCTTGATTACCAGGGGC -3'
(R):5'- CAGAATTTGTACTCTTGGGACTTTC -3'
Posted On2013-07-11