Incidental Mutation 'R7086:Gtse1'
ID549920
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene NameG two S phase expressed protein 1
SynonymsB99, Gtse-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85859745-85876573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85875549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 647 (D647G)
Ref Sequence ENSEMBL: ENSMUSP00000128759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023019] [ENSMUST00000162491] [ENSMUST00000170629] [ENSMUST00000231074]
Predicted Effect probably benign
Transcript: ENSMUST00000023019
SMART Domains Protein: ENSMUSP00000023019
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 133 7.7e-7 PFAM
Pfam:ThiI 3 79 7.7e-8 PFAM
Pfam:tRNA_Me_trans 5 383 3.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162491
SMART Domains Protein: ENSMUSP00000125704
Gene: ENSMUSG00000022386

DomainStartEndE-ValueType
Pfam:NAD_synthase 1 88 1.1e-8 PFAM
Pfam:Asn_synthase 1 90 3e-7 PFAM
Pfam:ThiI 3 84 1.6e-10 PFAM
Pfam:tRNA_Me_trans 5 88 2.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170629
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: D647G

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231074
AA Change: D647G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1580 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0576:Gtse1 UTSW 15 85869051 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5748:Gtse1 UTSW 15 85867577 missense probably benign
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6179:Gtse1 UTSW 15 85868957 missense possibly damaging 0.95
R6379:Gtse1 UTSW 15 85864224 missense probably benign 0.01
R6381:Gtse1 UTSW 15 85862148 missense probably benign 0.00
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
R7856:Gtse1 UTSW 15 85864141 missense probably benign 0.09
Z1176:Gtse1 UTSW 15 85868746 missense possibly damaging 0.85
Z1177:Gtse1 UTSW 15 85875737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGGCTGAAGCTCTATACTAGC -3'
(R):5'- AAGTCAGCACGAATCCCCTG -3'

Sequencing Primer
(F):5'- ATACTAGCTGTGGGTAGGGGTACAC -3'
(R):5'- AGCTCAGCCTTTGCAGG -3'
Posted On2019-05-15