Incidental Mutation 'R7087:Slc39a10'
ID549934
Institutional Source Beutler Lab
Gene Symbol Slc39a10
Ensembl Gene ENSMUSG00000025986
Gene Namesolute carrier family 39 (zinc transporter), member 10
Synonyms2900042E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R7087 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location46807544-46892852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46835720 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000027131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027131] [ENSMUST00000185520] [ENSMUST00000186852]
Predicted Effect probably damaging
Transcript: ENSMUST00000027131
AA Change: T141A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: T141A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
low complexity region 170 195 N/A INTRINSIC
low complexity region 224 244 N/A INTRINSIC
Pfam:Zip 406 607 9.9e-44 PFAM
Pfam:Zip 588 821 2.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185520
SMART Domains Protein: ENSMUSP00000140570
Gene: ENSMUSG00000025986

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186852
AA Change: T141A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140176
Gene: ENSMUSG00000025986
AA Change: T141A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 122 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,774,647 V252D probably damaging Het
Adprhl1 A G 8: 13,221,856 L1634P probably damaging Het
Arhgef4 A T 1: 34,811,686 R438W probably damaging Het
Asb3 A C 11: 30,998,321 K38T probably benign Het
Atp1a4 A T 1: 172,246,702 L328Q probably damaging Het
BC030500 T A 8: 58,912,354 I13N unknown Het
Cbarp A G 10: 80,136,408 S136P probably damaging Het
Ccdc18 T A 5: 108,196,122 D910E probably benign Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Cmya5 A G 13: 93,090,975 V2535A probably benign Het
Ddx39b C T 17: 35,253,049 R355C probably damaging Het
Dock10 T C 1: 80,592,826 T338A probably benign Het
Dpysl3 T C 18: 43,363,530 D147G probably damaging Het
Eif3i G T 4: 129,592,311 H284Q probably damaging Het
Erbb4 A T 1: 68,740,491 L42Q probably null Het
Exoc3l2 A G 7: 19,469,657 E58G Het
Fgf18 C T 11: 33,124,677 R98Q probably damaging Het
Gm14548 G A 7: 3,897,219 A128V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gp2 T A 7: 119,450,232 T361S probably damaging Het
Gtsf1 A T 15: 103,425,449 H33Q probably damaging Het
Hoxa4 G A 6: 52,191,291 T133M probably damaging Het
Hspb7 C A 4: 141,422,555 T84K possibly damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Kdm7a C T 6: 39,175,381 R127H probably benign Het
Lsm10 C T 4: 126,098,159 R103C probably damaging Het
Mgme1 T C 2: 144,272,181 S68P probably damaging Het
Nes G T 3: 87,979,758 V1775L probably benign Het
Nfrkb C T 9: 31,419,932 Q1250* probably null Het
Olfr1191-ps1 T C 2: 88,642,853 F29L probably damaging Het
Phf21b A T 15: 84,791,832 L338H probably damaging Het
Ppp2r5b A G 19: 6,232,550 V190A possibly damaging Het
Prmt1 T C 7: 44,981,583 probably null Het
Rusc1 A G 3: 89,089,492 V639A probably damaging Het
Slc24a2 T A 4: 86,991,219 probably null Het
Spta1 A T 1: 174,174,510 M69L probably benign Het
St8sia5 A C 18: 77,254,542 Q316P possibly damaging Het
Svs3a T C 2: 164,289,797 I96T possibly damaging Het
Syne1 T A 10: 5,542,024 probably benign Het
Trappc3 T C 4: 126,272,681 S16P probably benign Het
Vmn2r44 A T 7: 8,378,367 F176I probably benign Het
Wnk1 C T 6: 120,037,530 E35K possibly damaging Het
Zfp354c A G 11: 50,815,213 L345P probably damaging Het
Zfp608 T A 18: 54,899,397 K490N probably damaging Het
Zfp687 A C 3: 95,010,213 S709A probably benign Het
Other mutations in Slc39a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Slc39a10 APN 1 46819057 splice site probably benign
IGL01628:Slc39a10 APN 1 46835523 missense probably benign 0.23
IGL01939:Slc39a10 APN 1 46832735 missense probably benign 0.07
IGL02068:Slc39a10 APN 1 46819439 splice site probably benign
IGL02093:Slc39a10 APN 1 46835209 missense probably damaging 1.00
IGL02101:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02122:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02125:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02171:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02175:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02186:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02699:Slc39a10 APN 1 46818128 missense probably damaging 1.00
IGL02700:Slc39a10 APN 1 46818128 missense probably damaging 1.00
R0217:Slc39a10 UTSW 1 46835540 missense probably benign
R0704:Slc39a10 UTSW 1 46835861 missense possibly damaging 0.76
R0782:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R1527:Slc39a10 UTSW 1 46819262 missense probably benign
R1566:Slc39a10 UTSW 1 46836085 missense possibly damaging 0.90
R1568:Slc39a10 UTSW 1 46826215 missense probably benign 0.00
R1664:Slc39a10 UTSW 1 46826109 missense probably damaging 1.00
R1830:Slc39a10 UTSW 1 46836070 missense probably damaging 1.00
R1954:Slc39a10 UTSW 1 46835174 missense possibly damaging 0.50
R2327:Slc39a10 UTSW 1 46835996 missense probably damaging 0.97
R3434:Slc39a10 UTSW 1 46835717 missense probably benign
R3761:Slc39a10 UTSW 1 46812125 missense possibly damaging 0.88
R4035:Slc39a10 UTSW 1 46812074 missense probably damaging 1.00
R4419:Slc39a10 UTSW 1 46810066 missense probably benign 0.42
R4675:Slc39a10 UTSW 1 46817984 intron probably benign
R4689:Slc39a10 UTSW 1 46836013 missense probably benign 0.00
R5310:Slc39a10 UTSW 1 46836125 missense probably damaging 1.00
R6073:Slc39a10 UTSW 1 46832612 missense possibly damaging 0.68
R6161:Slc39a10 UTSW 1 46827407 missense probably damaging 1.00
R6199:Slc39a10 UTSW 1 46835833 missense probably damaging 1.00
R6562:Slc39a10 UTSW 1 46835564 missense probably benign 0.02
R7222:Slc39a10 UTSW 1 46819292 missense possibly damaging 0.82
R7286:Slc39a10 UTSW 1 46810070 missense probably damaging 0.97
R7568:Slc39a10 UTSW 1 46835130 missense probably benign 0.14
R7891:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
R7974:Slc39a10 UTSW 1 46812168 missense probably damaging 1.00
RF020:Slc39a10 UTSW 1 46810015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAACGTGACGAGTAGTGTTG -3'
(R):5'- CAAATTTTCAGTGCAGGATGCTG -3'

Sequencing Primer
(F):5'- TTGTGATCCAGGTGATGATGCAAAC -3'
(R):5'- TTCAGTGCAGGATGCTGAAAATG -3'
Posted On2019-05-15