Incidental Mutation 'R7087:Atp1a4'
ID549937
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene NameATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7087 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172223513-172258414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172246702 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 328 (L328Q)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
Predicted Effect probably damaging
Transcript: ENSMUST00000111243
AA Change: L328Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: L328Q

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,774,647 V252D probably damaging Het
Adprhl1 A G 8: 13,221,856 L1634P probably damaging Het
Arhgef4 A T 1: 34,811,686 R438W probably damaging Het
Asb3 A C 11: 30,998,321 K38T probably benign Het
BC030500 T A 8: 58,912,354 I13N unknown Het
Cbarp A G 10: 80,136,408 S136P probably damaging Het
Ccdc18 T A 5: 108,196,122 D910E probably benign Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Cmya5 A G 13: 93,090,975 V2535A probably benign Het
Ddx39b C T 17: 35,253,049 R355C probably damaging Het
Dock10 T C 1: 80,592,826 T338A probably benign Het
Dpysl3 T C 18: 43,363,530 D147G probably damaging Het
Eif3i G T 4: 129,592,311 H284Q probably damaging Het
Erbb4 A T 1: 68,740,491 L42Q probably null Het
Exoc3l2 A G 7: 19,469,657 E58G Het
Fgf18 C T 11: 33,124,677 R98Q probably damaging Het
Gm14548 G A 7: 3,897,219 A128V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gp2 T A 7: 119,450,232 T361S probably damaging Het
Gtsf1 A T 15: 103,425,449 H33Q probably damaging Het
Hoxa4 G A 6: 52,191,291 T133M probably damaging Het
Hspb7 C A 4: 141,422,555 T84K possibly damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Kdm7a C T 6: 39,175,381 R127H probably benign Het
Lsm10 C T 4: 126,098,159 R103C probably damaging Het
Mgme1 T C 2: 144,272,181 S68P probably damaging Het
Nes G T 3: 87,979,758 V1775L probably benign Het
Nfrkb C T 9: 31,419,932 Q1250* probably null Het
Olfr1191-ps1 T C 2: 88,642,853 F29L probably damaging Het
Phf21b A T 15: 84,791,832 L338H probably damaging Het
Ppp2r5b A G 19: 6,232,550 V190A possibly damaging Het
Prmt1 T C 7: 44,981,583 probably null Het
Rusc1 A G 3: 89,089,492 V639A probably damaging Het
Slc24a2 T A 4: 86,991,219 probably null Het
Slc39a10 T C 1: 46,835,720 T141A probably damaging Het
Spta1 A T 1: 174,174,510 M69L probably benign Het
St8sia5 A C 18: 77,254,542 Q316P possibly damaging Het
Svs3a T C 2: 164,289,797 I96T possibly damaging Het
Syne1 T A 10: 5,542,024 probably benign Het
Trappc3 T C 4: 126,272,681 S16P probably benign Het
Vmn2r44 A T 7: 8,378,367 F176I probably benign Het
Wnk1 C T 6: 120,037,530 E35K possibly damaging Het
Zfp354c A G 11: 50,815,213 L345P probably damaging Het
Zfp608 T A 18: 54,899,397 K490N probably damaging Het
Zfp687 A C 3: 95,010,213 S709A probably benign Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172240164 missense probably benign
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172234477 missense probably benign
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172234431 missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5234:Atp1a4 UTSW 1 172227170 missense possibly damaging 0.73
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172244408 missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
R7122:Atp1a4 UTSW 1 172231936 missense possibly damaging 0.47
R7381:Atp1a4 UTSW 1 172240115 missense possibly damaging 0.70
R7431:Atp1a4 UTSW 1 172250907 missense probably benign 0.31
Z1176:Atp1a4 UTSW 1 172231954 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTGACGCTTCTATGTATCTCAGG -3'
(R):5'- GAACAGCTCGGGGTATTGTG -3'

Sequencing Primer
(F):5'- GGATACCCCTCACTTCAGATG -3'
(R):5'- TGTGATTGCTACAGGAGACTACAC -3'
Posted On2019-05-15