Incidental Mutation 'R0615:Sema6d'
ID54995
Institutional Source Beutler Lab
Gene Symbol Sema6d
Ensembl Gene ENSMUSG00000027200
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D
SynonymsSema6D-6, 1110067B02Rik, Sema6D-1, Sema6D-2, Sema6D-4, Sema6D-5
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location124089969-124667770 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 124654135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051419] [ENSMUST00000076335] [ENSMUST00000077847] [ENSMUST00000078621] [ENSMUST00000103238] [ENSMUST00000103239] [ENSMUST00000103240] [ENSMUST00000103241]
Predicted Effect probably benign
Transcript: ENSMUST00000051419
SMART Domains Protein: ENSMUSP00000061123
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 743 764 N/A INTRINSIC
internal_repeat_1 797 898 7.43e-5 PROSPERO
internal_repeat_1 892 1004 7.43e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000076335
SMART Domains Protein: ENSMUSP00000075674
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000077847
SMART Domains Protein: ENSMUSP00000077014
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000078621
SMART Domains Protein: ENSMUSP00000077691
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 582 4.57e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 762 783 N/A INTRINSIC
internal_repeat_1 816 917 8.83e-5 PROSPERO
internal_repeat_1 911 1023 8.83e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103238
SMART Domains Protein: ENSMUSP00000099528
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 573 584 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
low complexity region 786 807 N/A INTRINSIC
internal_repeat_1 840 941 5.95e-5 PROSPERO
internal_repeat_1 935 1047 5.95e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103239
SMART Domains Protein: ENSMUSP00000099529
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
low complexity region 805 826 N/A INTRINSIC
internal_repeat_1 859 960 5.78e-5 PROSPERO
internal_repeat_1 954 1066 5.78e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103240
SMART Domains Protein: ENSMUSP00000099530
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
low complexity region 587 603 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 801 822 N/A INTRINSIC
internal_repeat_1 855 956 5.63e-5 PROSPERO
internal_repeat_1 950 1062 5.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103241
SMART Domains Protein: ENSMUSP00000099531
Gene: ENSMUSG00000027200

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 57 487 7.29e-184 SMART
PSI 514 569 1.12e-1 SMART
transmembrane domain 589 611 N/A INTRINSIC
low complexity region 730 751 N/A INTRINSIC
internal_repeat_1 784 885 7.28e-5 PROSPERO
internal_repeat_1 879 991 7.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132088
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal dendritic cell trafficking and antigen-specific T cell priming. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Sema6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Sema6d APN 2 124659865 missense possibly damaging 0.91
IGL00508:Sema6d APN 2 124656924 splice site probably benign
IGL00710:Sema6d APN 2 124662288 missense probably benign 0.00
IGL00811:Sema6d APN 2 124658469 missense probably damaging 1.00
IGL01457:Sema6d APN 2 124653642 missense unknown
IGL01524:Sema6d APN 2 124664075 missense possibly damaging 0.86
IGL01598:Sema6d APN 2 124665098 missense probably damaging 1.00
IGL01915:Sema6d APN 2 124658571 splice site probably benign
IGL02365:Sema6d APN 2 124656868 missense probably benign 0.14
IGL02698:Sema6d APN 2 124653723 missense possibly damaging 0.95
IGL02865:Sema6d APN 2 124664073 missense probably damaging 1.00
IGL03018:Sema6d APN 2 124659600 missense possibly damaging 0.95
IGL03333:Sema6d APN 2 124664370 missense possibly damaging 0.83
R0269:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0390:Sema6d UTSW 2 124658490 missense probably damaging 1.00
R0541:Sema6d UTSW 2 124665277 missense probably damaging 1.00
R0617:Sema6d UTSW 2 124660745 missense possibly damaging 0.63
R0694:Sema6d UTSW 2 124664041 missense probably damaging 1.00
R0854:Sema6d UTSW 2 124665302 missense probably damaging 0.97
R1630:Sema6d UTSW 2 124664345 missense possibly damaging 0.89
R1682:Sema6d UTSW 2 124665149 missense probably benign 0.21
R1823:Sema6d UTSW 2 124659556 splice site probably null
R1932:Sema6d UTSW 2 124659886 critical splice donor site probably null
R2249:Sema6d UTSW 2 124659588 missense possibly damaging 0.54
R2256:Sema6d UTSW 2 124664150 missense probably damaging 1.00
R2331:Sema6d UTSW 2 124658063 missense probably damaging 1.00
R2910:Sema6d UTSW 2 124665037 missense probably damaging 1.00
R3683:Sema6d UTSW 2 124654226 missense possibly damaging 0.88
R3937:Sema6d UTSW 2 124656850 missense probably benign 0.00
R4135:Sema6d UTSW 2 124664120 missense probably damaging 0.96
R4446:Sema6d UTSW 2 124664059 missense probably damaging 0.98
R4583:Sema6d UTSW 2 124664162 missense probably damaging 1.00
R4599:Sema6d UTSW 2 124654231 missense probably damaging 1.00
R4822:Sema6d UTSW 2 124662294 missense possibly damaging 0.79
R4884:Sema6d UTSW 2 124656818 splice site probably null
R5288:Sema6d UTSW 2 124664246 missense probably damaging 1.00
R5443:Sema6d UTSW 2 124656836 missense probably damaging 1.00
R5504:Sema6d UTSW 2 124658021 missense probably damaging 1.00
R5534:Sema6d UTSW 2 124659815 missense possibly damaging 0.75
R5615:Sema6d UTSW 2 124656901 missense probably damaging 0.97
R5747:Sema6d UTSW 2 124664947 missense probably damaging 0.99
R5866:Sema6d UTSW 2 124664342 missense probably benign 0.26
R5980:Sema6d UTSW 2 124664708 missense probably damaging 1.00
R6670:Sema6d UTSW 2 124654842 small deletion probably benign
R6803:Sema6d UTSW 2 124664050 missense probably damaging 0.96
R7023:Sema6d UTSW 2 124664911 missense probably damaging 1.00
R7068:Sema6d UTSW 2 124657821 missense probably benign
R7426:Sema6d UTSW 2 124654158 missense probably damaging 1.00
R7556:Sema6d UTSW 2 124654189 missense probably damaging 1.00
R7569:Sema6d UTSW 2 124657972 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAACTGAGCCAGTTCTGTTGGGCG -3'
(R):5'- GGCAAACTGACTGGGCATAAGCAC -3'

Sequencing Primer
(F):5'- TGCAGCAGCCCAGACATAG -3'
(R):5'- TCTGGATGTGACACTGAACGC -3'
Posted On2013-07-11