Incidental Mutation 'R7087:Exoc3l2'
ID549956
Institutional Source Beutler Lab
Gene Symbol Exoc3l2
Ensembl Gene ENSMUSG00000011263
Gene Nameexocyst complex component 3-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R7087 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19463331-19496762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19469657 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 58 (E58G)
Ref Sequence ENSEMBL: ENSMUSP00000123025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137613]
Predicted Effect
SMART Domains Protein: ENSMUSP00000123025
Gene: ENSMUSG00000011263
AA Change: E58G

DomainStartEndE-ValueType
Pfam:Sec6 1 177 7.7e-29 PFAM
low complexity region 186 222 N/A INTRINSIC
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,774,647 V252D probably damaging Het
Adprhl1 A G 8: 13,221,856 L1634P probably damaging Het
Arhgef4 A T 1: 34,811,686 R438W probably damaging Het
Asb3 A C 11: 30,998,321 K38T probably benign Het
Atp1a4 A T 1: 172,246,702 L328Q probably damaging Het
BC030500 T A 8: 58,912,354 I13N unknown Het
Cbarp A G 10: 80,136,408 S136P probably damaging Het
Ccdc18 T A 5: 108,196,122 D910E probably benign Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Cmya5 A G 13: 93,090,975 V2535A probably benign Het
Ddx39b C T 17: 35,253,049 R355C probably damaging Het
Dock10 T C 1: 80,592,826 T338A probably benign Het
Dpysl3 T C 18: 43,363,530 D147G probably damaging Het
Eif3i G T 4: 129,592,311 H284Q probably damaging Het
Erbb4 A T 1: 68,740,491 L42Q probably null Het
Fgf18 C T 11: 33,124,677 R98Q probably damaging Het
Gm14548 G A 7: 3,897,219 A128V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gp2 T A 7: 119,450,232 T361S probably damaging Het
Gtsf1 A T 15: 103,425,449 H33Q probably damaging Het
Hoxa4 G A 6: 52,191,291 T133M probably damaging Het
Hspb7 C A 4: 141,422,555 T84K possibly damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Kdm7a C T 6: 39,175,381 R127H probably benign Het
Lsm10 C T 4: 126,098,159 R103C probably damaging Het
Mgme1 T C 2: 144,272,181 S68P probably damaging Het
Nes G T 3: 87,979,758 V1775L probably benign Het
Nfrkb C T 9: 31,419,932 Q1250* probably null Het
Olfr1191-ps1 T C 2: 88,642,853 F29L probably damaging Het
Phf21b A T 15: 84,791,832 L338H probably damaging Het
Ppp2r5b A G 19: 6,232,550 V190A possibly damaging Het
Prmt1 T C 7: 44,981,583 probably null Het
Rusc1 A G 3: 89,089,492 V639A probably damaging Het
Slc24a2 T A 4: 86,991,219 probably null Het
Slc39a10 T C 1: 46,835,720 T141A probably damaging Het
Spta1 A T 1: 174,174,510 M69L probably benign Het
St8sia5 A C 18: 77,254,542 Q316P possibly damaging Het
Svs3a T C 2: 164,289,797 I96T possibly damaging Het
Syne1 T A 10: 5,542,024 probably benign Het
Trappc3 T C 4: 126,272,681 S16P probably benign Het
Vmn2r44 A T 7: 8,378,367 F176I probably benign Het
Wnk1 C T 6: 120,037,530 E35K possibly damaging Het
Zfp354c A G 11: 50,815,213 L345P probably damaging Het
Zfp608 T A 18: 54,899,397 K490N probably damaging Het
Zfp687 A C 3: 95,010,213 S709A probably benign Het
Other mutations in Exoc3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02858:Exoc3l2 APN 7 19495184 missense probably benign 0.05
Thumbelina UTSW 7 19480032 missense unknown
R1220:Exoc3l2 UTSW 7 19491784 splice site probably benign
R1482:Exoc3l2 UTSW 7 19495359 missense probably damaging 0.99
R2109:Exoc3l2 UTSW 7 19489134 start gained probably benign
R2117:Exoc3l2 UTSW 7 19494982 missense possibly damaging 0.92
R3963:Exoc3l2 UTSW 7 19495256 missense probably benign
R4870:Exoc3l2 UTSW 7 19495192 missense unknown
R5982:Exoc3l2 UTSW 7 19480032 missense unknown
R6151:Exoc3l2 UTSW 7 19491745 nonsense probably null
R6351:Exoc3l2 UTSW 7 19469708 missense possibly damaging 0.66
R6376:Exoc3l2 UTSW 7 19469710 missense possibly damaging 0.90
R7256:Exoc3l2 UTSW 7 19484703 missense unknown
R7493:Exoc3l2 UTSW 7 19469888 missense
R8472:Exoc3l2 UTSW 7 19481265 nonsense probably null
R8745:Exoc3l2 UTSW 7 19481287 missense unknown
X0064:Exoc3l2 UTSW 7 19494972 missense probably benign 0.27
Z1176:Exoc3l2 UTSW 7 19480061 missense probably null
Z1177:Exoc3l2 UTSW 7 19480028 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCACTAACACCACCTCGG -3'
(R):5'- TCAGGAAAGCCAGTCTTCGAG -3'

Sequencing Primer
(F):5'- GTGCCAGCCTGTCAAAAATG -3'
(R):5'- TTCGAGCGGCTTCTCCAG -3'
Posted On2019-05-15