Incidental Mutation 'R7087:St8sia5'
ID549975
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7087 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77254542 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 316 (Q316P)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075290
AA Change: Q316P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: Q316P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079618
AA Change: Q280P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: Q280P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,774,647 V252D probably damaging Het
Adprhl1 A G 8: 13,221,856 L1634P probably damaging Het
Arhgef4 A T 1: 34,811,686 R438W probably damaging Het
Asb3 A C 11: 30,998,321 K38T probably benign Het
Atp1a4 A T 1: 172,246,702 L328Q probably damaging Het
BC030500 T A 8: 58,912,354 I13N unknown Het
Cbarp A G 10: 80,136,408 S136P probably damaging Het
Ccdc18 T A 5: 108,196,122 D910E probably benign Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Cmya5 A G 13: 93,090,975 V2535A probably benign Het
Ddx39b C T 17: 35,253,049 R355C probably damaging Het
Dock10 T C 1: 80,592,826 T338A probably benign Het
Dpysl3 T C 18: 43,363,530 D147G probably damaging Het
Eif3i G T 4: 129,592,311 H284Q probably damaging Het
Erbb4 A T 1: 68,740,491 L42Q probably null Het
Exoc3l2 A G 7: 19,469,657 E58G Het
Fgf18 C T 11: 33,124,677 R98Q probably damaging Het
Gm14548 G A 7: 3,897,219 A128V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gp2 T A 7: 119,450,232 T361S probably damaging Het
Gtsf1 A T 15: 103,425,449 H33Q probably damaging Het
Hoxa4 G A 6: 52,191,291 T133M probably damaging Het
Hspb7 C A 4: 141,422,555 T84K possibly damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Kdm7a C T 6: 39,175,381 R127H probably benign Het
Lsm10 C T 4: 126,098,159 R103C probably damaging Het
Mgme1 T C 2: 144,272,181 S68P probably damaging Het
Nes G T 3: 87,979,758 V1775L probably benign Het
Nfrkb C T 9: 31,419,932 Q1250* probably null Het
Olfr1191-ps1 T C 2: 88,642,853 F29L probably damaging Het
Phf21b A T 15: 84,791,832 L338H probably damaging Het
Ppp2r5b A G 19: 6,232,550 V190A possibly damaging Het
Prmt1 T C 7: 44,981,583 probably null Het
Rusc1 A G 3: 89,089,492 V639A probably damaging Het
Slc24a2 T A 4: 86,991,219 probably null Het
Slc39a10 T C 1: 46,835,720 T141A probably damaging Het
Spta1 A T 1: 174,174,510 M69L probably benign Het
Svs3a T C 2: 164,289,797 I96T possibly damaging Het
Syne1 T A 10: 5,542,024 probably benign Het
Trappc3 T C 4: 126,272,681 S16P probably benign Het
Vmn2r44 A T 7: 8,378,367 F176I probably benign Het
Wnk1 C T 6: 120,037,530 E35K possibly damaging Het
Zfp354c A G 11: 50,815,213 L345P probably damaging Het
Zfp608 T A 18: 54,899,397 K490N probably damaging Het
Zfp687 A C 3: 95,010,213 S709A probably benign Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7020:St8sia5 UTSW 18 77246180 missense probably damaging 0.97
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCAGGTTCCACAAGTTG -3'
(R):5'- CAGGAAGGTGAAGATCTCCG -3'

Sequencing Primer
(F):5'- CACAAGTTGGAGAAGTGGCG -3'
(R):5'- CATAGCATGGAAACCCGGCTTG -3'
Posted On2019-05-15