Mutagenetix > Incidental Mutation

Incidental Mutation 'R7088:Slc9a2'

549978

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

045182-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R7088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 40726379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 310 (I310L)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: I310L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I310L

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192345
AA Change: I310L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I310L

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
2410089E03Rik	C	T	15: 8,218,947	T1660M	probably benign	Het
5830473C10Rik	T	A	5: 90,572,750	L260*	probably null	Het
Acaca	T	C	11: 84,278,957		probably null	Het
AI314180	A	T	4: 58,849,766	L458I	possibly damaging	Het
Alkbh3	A	G	2: 94,004,752	S83P	possibly damaging	Het
Ammecr1l	T	C	18: 31,771,819	S38P	probably benign	Het
Armc10	T	C	5: 21,653,392	V145A	probably damaging	Het
BC048671	A	G	6: 90,303,240	K46R	probably null	Het
C2cd3	A	G	7: 100,416,181	T347A		Het
C8b	G	T	4: 104,793,343	E449D	probably benign	Het
Camk4	T	C	18: 32,939,531	S46P	probably benign	Het
Ccdc113	G	A	8: 95,538,105	R81H	probably benign	Het
Cd177	A	T	7: 24,745,133	C674*	probably null	Het
Cdc6	T	A	11: 98,919,239	V458D	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Ckap2	G	T	8: 22,169,866	P533Q	possibly damaging	Het
Cma1	T	A	14: 55,943,816	H44L	probably damaging	Het
Cmya5	A	T	13: 93,091,864	S2239T	possibly damaging	Het
Cntnap5b	T	A	1: 100,160,077	I141N	probably damaging	Het
Col6a4	T	A	9: 106,000,686	T2031S	possibly damaging	Het
Cxcr5	T	A	9: 44,513,386	T325S	possibly damaging	Het
Dhx32	A	T	7: 133,742,688	L204Q	probably damaging	Het
Dse	A	G	10: 34,153,889	Y402H	probably damaging	Het
Exoc6	G	T	19: 37,577,010	C178F	probably damaging	Het
Fam149a	A	G	8: 45,350,545	V384A	probably benign	Het
Fcrl5	T	C	3: 87,457,834	*597Q	probably null	Het
Fer1l6	A	G	15: 58,564,050	K431E	possibly damaging	Het
Fmo3	T	A	1: 162,968,865	H46L	probably benign	Het
Gcm2	T	C	13: 41,103,364	D303G	probably damaging	Het
Gk2	T	C	5: 97,455,675	M435V	probably damaging	Het
Gli1	C	A	10: 127,335,999	M295I	probably damaging	Het
Gm11444	G	T	11: 85,847,036	H109Q		Het
Gtpbp1	T	A	15: 79,719,282	D182E		Het
Hnf4g	A	T	3: 3,648,125		probably null	Het
Hsf2	G	A	10: 57,512,092	R483H	probably damaging	Het
Kcnq4	C	T	4: 120,704,399	R491H	probably damaging	Het
Lama3	T	C	18: 12,582,545	V1686A	possibly damaging	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Mboat1	T	G	13: 30,195,789		probably null	Het
Mdh1	T	C	11: 21,558,484	Y286C	probably damaging	Het
Mga	G	T	2: 119,961,936	K2607N	probably damaging	Het
Morf4l1	C	A	9: 90,097,380	V183F	possibly damaging	Het
Mroh4	G	A	15: 74,626,144	R196W	probably benign	Het
Muc16	C	A	9: 18,592,680	M6438I	probably damaging	Het
Myom3	A	G	4: 135,803,278	Y1167C	probably damaging	Het
Neurl3	T	C	1: 36,269,221	E170G	possibly damaging	Het
Nsd3	T	C	8: 25,666,034	I539T	probably benign	Het
Nup155	T	C	15: 8,156,693	F1313S	probably benign	Het
Nxn	A	T	11: 76,263,148	V287E	possibly damaging	Het
Olfr1253	G	A	2: 89,752,099	T243I	probably benign	Het
Olfr1354	A	C	10: 78,917,759	L306F	probably benign	Het
Olfr891	C	A	9: 38,180,452	V124F	probably damaging	Het
Pax6	A	G	2: 105,696,408	N220D	probably benign	Het
Pcdha11	G	A	18: 37,005,417	R33H	probably benign	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pear1	C	A	3: 87,754,638	V477F	possibly damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pidd1	A	T	7: 141,440,487	V539E	probably damaging	Het
Ptprg	A	T	14: 12,207,365	I878F	probably damaging	Het
Rabepk	T	C	2: 34,785,699	T140A	probably benign	Het
Ranbp2	G	T	10: 58,463,906	R454L	probably damaging	Het
Rnf123	C	T	9: 108,058,536	R943Q	probably null	Het
Sash1	G	A	10: 8,729,717	R970*	probably null	Het
Serpinb2	C	A	1: 107,524,692	F333L	probably damaging	Het
Shank3	T	A	15: 89,503,525		probably null	Het
Strip2	T	A	6: 29,920,533		probably null	Het
Thoc3	T	C	13: 54,463,752	T241A	probably damaging	Het
Tmem139	T	A	6: 42,263,265	V2E	probably damaging	Het
Usp24	G	T	4: 106,387,546	V1233F	probably damaging	Het
Vnn1	A	G	10: 23,900,747	Q332R	probably benign	Het
Wac	T	A	18: 7,921,455	H530Q	probably damaging	Het
Wdr35	T	A	12: 8,978,659	N92K	probably benign	Het
Zbtb18	T	G	1: 177,447,254	L60R	probably damaging	Het
Zfp184	T	A	13: 21,959,992	C623S	probably damaging	Het
Zfp292	A	G	4: 34,806,796	Y2088H	probably damaging	Het
Zfp975	G	T	7: 42,662,672	S172R	probably benign	Het
Zswim2	G	A	2: 83,915,727	Q456*	probably null	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTGTACAACTTGTTCAAGTC -3'
(R):5'- CAGCTCCACATTGCAGTAGC -3'

Sequencing Primer
(F):5'- GTCCTTCTGCCAGATGAAAAC -3'
(R):5'- CTTTCATTTCGGTGTAACAAAAGG -3'

Posted On

2019-05-15