Incidental Mutation 'R7088:Slc9a2'
ID 549978
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, NHE2, 4932415O19Rik
MMRRC Submission 045182-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7088 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40720872-40808045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 40765539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 310 (I310L)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
AlphaFold Q3ZAS0
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: I310L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I310L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: I310L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I310L

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,331,232 (GRCm39) E48* probably null Het
Acaca T C 11: 84,169,783 (GRCm39) probably null Het
Albfm1 T A 5: 90,720,609 (GRCm39) L260* probably null Het
Alkbh3 A G 2: 93,835,097 (GRCm39) S83P possibly damaging Het
Ammecr1l T C 18: 31,904,872 (GRCm39) S38P probably benign Het
Armc10 T C 5: 21,858,390 (GRCm39) V145A probably damaging Het
BC048671 A G 6: 90,280,222 (GRCm39) K46R probably null Het
C2cd3 A G 7: 100,065,388 (GRCm39) T347A Het
C8b G T 4: 104,650,540 (GRCm39) E449D probably benign Het
Camk4 T C 18: 33,072,584 (GRCm39) S46P probably benign Het
Ccdc113 G A 8: 96,264,733 (GRCm39) R81H probably benign Het
Cd177 A T 7: 24,444,558 (GRCm39) C674* probably null Het
Cdc6 T A 11: 98,810,065 (GRCm39) V458D probably damaging Het
Cenpo C T 12: 4,265,307 (GRCm39) E238K probably benign Het
Ckap2 G T 8: 22,659,882 (GRCm39) P533Q possibly damaging Het
Cma1 T A 14: 56,181,273 (GRCm39) H44L probably damaging Het
Cmya5 A T 13: 93,228,372 (GRCm39) S2239T possibly damaging Het
Cntnap5b T A 1: 100,087,802 (GRCm39) I141N probably damaging Het
Col6a4 T A 9: 105,877,885 (GRCm39) T2031S possibly damaging Het
Cplane1 C T 15: 8,248,431 (GRCm39) T1660M probably benign Het
Cxcr5 T A 9: 44,424,683 (GRCm39) T325S possibly damaging Het
Dhx32 A T 7: 133,344,417 (GRCm39) L204Q probably damaging Het
Dse A G 10: 34,029,885 (GRCm39) Y402H probably damaging Het
Ecpas A T 4: 58,849,766 (GRCm39) L458I possibly damaging Het
Exoc6 G T 19: 37,565,458 (GRCm39) C178F probably damaging Het
Fam149a A G 8: 45,803,582 (GRCm39) V384A probably benign Het
Fcrl5 T C 3: 87,365,141 (GRCm39) *597Q probably null Het
Fer1l6 A G 15: 58,435,899 (GRCm39) K431E possibly damaging Het
Fmo3 T A 1: 162,796,434 (GRCm39) H46L probably benign Het
Gcm2 T C 13: 41,256,840 (GRCm39) D303G probably damaging Het
Gk2 T C 5: 97,603,534 (GRCm39) M435V probably damaging Het
Gli1 C A 10: 127,171,868 (GRCm39) M295I probably damaging Het
Gm11444 G T 11: 85,737,862 (GRCm39) H109Q Het
Gtpbp1 T A 15: 79,603,483 (GRCm39) D182E Het
Hnf4g A T 3: 3,713,185 (GRCm39) probably null Het
Hsf2 G A 10: 57,388,188 (GRCm39) R483H probably damaging Het
Kcnq4 C T 4: 120,561,596 (GRCm39) R491H probably damaging Het
Lama3 T C 18: 12,715,602 (GRCm39) V1686A possibly damaging Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Mboat1 T G 13: 30,379,772 (GRCm39) probably null Het
Mdh1 T C 11: 21,508,484 (GRCm39) Y286C probably damaging Het
Mga G T 2: 119,792,417 (GRCm39) K2607N probably damaging Het
Morf4l1 C A 9: 89,979,433 (GRCm39) V183F possibly damaging Het
Mroh4 G A 15: 74,497,993 (GRCm39) R196W probably benign Het
Muc16 C A 9: 18,503,976 (GRCm39) M6438I probably damaging Het
Myom3 A G 4: 135,530,589 (GRCm39) Y1167C probably damaging Het
Neurl3 T C 1: 36,308,302 (GRCm39) E170G possibly damaging Het
Nsd3 T C 8: 26,156,050 (GRCm39) I539T probably benign Het
Nup155 T C 15: 8,186,177 (GRCm39) F1313S probably benign Het
Nxn A T 11: 76,153,974 (GRCm39) V287E possibly damaging Het
Or4a80 G A 2: 89,582,443 (GRCm39) T243I probably benign Het
Or7a38 A C 10: 78,753,593 (GRCm39) L306F probably benign Het
Or8c13 C A 9: 38,091,748 (GRCm39) V124F probably damaging Het
Pax6 A G 2: 105,526,753 (GRCm39) N220D probably benign Het
Pcdha11 G A 18: 37,138,470 (GRCm39) R33H probably benign Het
Pdzd8 A G 19: 59,333,389 (GRCm39) F211L probably damaging Het
Pear1 C A 3: 87,661,945 (GRCm39) V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pidd1 A T 7: 141,020,400 (GRCm39) V539E probably damaging Het
Ptprg A T 14: 12,207,365 (GRCm38) I878F probably damaging Het
Rabepk T C 2: 34,675,711 (GRCm39) T140A probably benign Het
Ranbp2 G T 10: 58,299,728 (GRCm39) R454L probably damaging Het
Rnf123 C T 9: 107,935,735 (GRCm39) R943Q probably null Het
Sash1 G A 10: 8,605,481 (GRCm39) R970* probably null Het
Serpinb2 C A 1: 107,452,422 (GRCm39) F333L probably damaging Het
Shank3 T A 15: 89,387,728 (GRCm39) probably null Het
Strip2 T A 6: 29,920,532 (GRCm39) probably null Het
Thoc3 T C 13: 54,611,565 (GRCm39) T241A probably damaging Het
Tmem139 T A 6: 42,240,199 (GRCm39) V2E probably damaging Het
Usp24 G T 4: 106,244,743 (GRCm39) V1233F probably damaging Het
Vnn1 A G 10: 23,776,645 (GRCm39) Q332R probably benign Het
Wac T A 18: 7,921,455 (GRCm39) H530Q probably damaging Het
Wdr35 T A 12: 9,028,659 (GRCm39) N92K probably benign Het
Zbtb18 T G 1: 177,274,820 (GRCm39) L60R probably damaging Het
Zfp184 T A 13: 22,144,162 (GRCm39) C623S probably damaging Het
Zfp292 A G 4: 34,806,796 (GRCm39) Y2088H probably damaging Het
Zfp975 G T 7: 42,312,096 (GRCm39) S172R probably benign Het
Zswim2 G A 2: 83,746,071 (GRCm39) Q456* probably null Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40,806,897 (GRCm39) missense probably benign
IGL00487:Slc9a2 APN 1 40,781,818 (GRCm39) missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40,802,743 (GRCm39) missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40,757,970 (GRCm39) missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40,795,453 (GRCm39) missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40,781,829 (GRCm39) missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40,802,762 (GRCm39) missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40,781,863 (GRCm39) missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40,795,431 (GRCm39) missense probably benign 0.00
putty UTSW 1 40,781,813 (GRCm39) nonsense probably null
E0370:Slc9a2 UTSW 1 40,802,701 (GRCm39) critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40,783,001 (GRCm39) missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40,781,964 (GRCm39) missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40,783,017 (GRCm39) missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40,758,178 (GRCm39) missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40,765,548 (GRCm39) missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40,802,770 (GRCm39) missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40,781,803 (GRCm39) missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40,765,597 (GRCm39) missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40,781,928 (GRCm39) missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40,781,768 (GRCm39) splice site probably null
R3612:Slc9a2 UTSW 1 40,758,218 (GRCm39) splice site probably null
R4631:Slc9a2 UTSW 1 40,801,078 (GRCm39) missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40,801,076 (GRCm39) missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40,758,009 (GRCm39) missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40,794,878 (GRCm39) missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40,783,053 (GRCm39) missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40,721,196 (GRCm39) missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40,781,813 (GRCm39) nonsense probably null
R6453:Slc9a2 UTSW 1 40,781,781 (GRCm39) missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40,758,069 (GRCm39) missense probably damaging 0.99
R7302:Slc9a2 UTSW 1 40,806,828 (GRCm39) missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40,720,995 (GRCm39) start gained probably benign
R7670:Slc9a2 UTSW 1 40,758,157 (GRCm39) missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40,765,374 (GRCm39) missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40,757,809 (GRCm39) missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40,758,009 (GRCm39) missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40,765,612 (GRCm39) missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40,794,944 (GRCm39) missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40,805,460 (GRCm39) missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40,806,987 (GRCm39) missense probably benign 0.00
R9400:Slc9a2 UTSW 1 40,758,211 (GRCm39) missense possibly damaging 0.65
R9512:Slc9a2 UTSW 1 40,721,258 (GRCm39) missense probably damaging 0.98
R9583:Slc9a2 UTSW 1 40,721,061 (GRCm39) missense probably benign
X0054:Slc9a2 UTSW 1 40,781,847 (GRCm39) missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40,806,871 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTGTACAACTTGTTCAAGTC -3'
(R):5'- CAGCTCCACATTGCAGTAGC -3'

Sequencing Primer
(F):5'- GTCCTTCTGCCAGATGAAAAC -3'
(R):5'- CTTTCATTTCGGTGTAACAAAAGG -3'
Posted On 2019-05-15