Mutagenetix > Incidental Mutation

Incidental Mutation 'R7088:Cntnap5b'

549979

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5b

Ensembl Gene

ENSMUSG00000067028

Gene Name

contactin associated protein-like 5B

Synonyms

Caspr5-2, C230078M14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R7088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99772765-100485942 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100160077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 141 (I141N)

Ref Sequence

ENSEMBL: ENSMUSP00000139877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]

AlphaFold

Q0V8T8

Predicted Effect

probably damaging
Transcript: ENSMUST00000086738
AA Change: I455N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: I455N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	39	174	2.76e-16	SMART
LamG	201	338	2.84e-27	SMART
LamG	387	521	9.22e-27	SMART
EGF	549	583	1.14e0	SMART
Blast:FBG	586	758	3e-66	BLAST
LamG	798	925	2.12e-26	SMART
EGF	946	982	1.51e0	SMART
LamG	1023	1159	2.14e-13	SMART
transmembrane domain	1227	1249	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000188735
AA Change: I141N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: I141N

Domain	Start	End	E-Value	Type
LamG	73	207	5.9e-29	SMART
EGF	235	269	5.6e-3	SMART
Blast:FBG	272	402	2e-42	BLAST
LamG	415	554	2.5e-11	SMART
EGF	575	611	7.1e-3	SMART
LamG	652	788	1.4e-15	SMART
transmembrane domain	856	878	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
2410089E03Rik	C	T	15: 8,218,947	T1660M	probably benign	Het
5830473C10Rik	T	A	5: 90,572,750	L260*	probably null	Het
Acaca	T	C	11: 84,278,957		probably null	Het
AI314180	A	T	4: 58,849,766	L458I	possibly damaging	Het
Alkbh3	A	G	2: 94,004,752	S83P	possibly damaging	Het
Ammecr1l	T	C	18: 31,771,819	S38P	probably benign	Het
Armc10	T	C	5: 21,653,392	V145A	probably damaging	Het
BC048671	A	G	6: 90,303,240	K46R	probably null	Het
C2cd3	A	G	7: 100,416,181	T347A		Het
C8b	G	T	4: 104,793,343	E449D	probably benign	Het
Camk4	T	C	18: 32,939,531	S46P	probably benign	Het
Ccdc113	G	A	8: 95,538,105	R81H	probably benign	Het
Cd177	A	T	7: 24,745,133	C674*	probably null	Het
Cdc6	T	A	11: 98,919,239	V458D	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Ckap2	G	T	8: 22,169,866	P533Q	possibly damaging	Het
Cma1	T	A	14: 55,943,816	H44L	probably damaging	Het
Cmya5	A	T	13: 93,091,864	S2239T	possibly damaging	Het
Col6a4	T	A	9: 106,000,686	T2031S	possibly damaging	Het
Cxcr5	T	A	9: 44,513,386	T325S	possibly damaging	Het
Dhx32	A	T	7: 133,742,688	L204Q	probably damaging	Het
Dse	A	G	10: 34,153,889	Y402H	probably damaging	Het
Exoc6	G	T	19: 37,577,010	C178F	probably damaging	Het
Fam149a	A	G	8: 45,350,545	V384A	probably benign	Het
Fcrl5	T	C	3: 87,457,834	*597Q	probably null	Het
Fer1l6	A	G	15: 58,564,050	K431E	possibly damaging	Het
Fmo3	T	A	1: 162,968,865	H46L	probably benign	Het
Gcm2	T	C	13: 41,103,364	D303G	probably damaging	Het
Gk2	T	C	5: 97,455,675	M435V	probably damaging	Het
Gli1	C	A	10: 127,335,999	M295I	probably damaging	Het
Gm11444	G	T	11: 85,847,036	H109Q		Het
Gtpbp1	T	A	15: 79,719,282	D182E		Het
Hnf4g	A	T	3: 3,648,125		probably null	Het
Hsf2	G	A	10: 57,512,092	R483H	probably damaging	Het
Kcnq4	C	T	4: 120,704,399	R491H	probably damaging	Het
Lama3	T	C	18: 12,582,545	V1686A	possibly damaging	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Mboat1	T	G	13: 30,195,789		probably null	Het
Mdh1	T	C	11: 21,558,484	Y286C	probably damaging	Het
Mga	G	T	2: 119,961,936	K2607N	probably damaging	Het
Morf4l1	C	A	9: 90,097,380	V183F	possibly damaging	Het
Mroh4	G	A	15: 74,626,144	R196W	probably benign	Het
Muc16	C	A	9: 18,592,680	M6438I	probably damaging	Het
Myom3	A	G	4: 135,803,278	Y1167C	probably damaging	Het
Neurl3	T	C	1: 36,269,221	E170G	possibly damaging	Het
Nsd3	T	C	8: 25,666,034	I539T	probably benign	Het
Nup155	T	C	15: 8,156,693	F1313S	probably benign	Het
Nxn	A	T	11: 76,263,148	V287E	possibly damaging	Het
Olfr1253	G	A	2: 89,752,099	T243I	probably benign	Het
Olfr1354	A	C	10: 78,917,759	L306F	probably benign	Het
Olfr891	C	A	9: 38,180,452	V124F	probably damaging	Het
Pax6	A	G	2: 105,696,408	N220D	probably benign	Het
Pcdha11	G	A	18: 37,005,417	R33H	probably benign	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pear1	C	A	3: 87,754,638	V477F	possibly damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pidd1	A	T	7: 141,440,487	V539E	probably damaging	Het
Ptprg	A	T	14: 12,207,365	I878F	probably damaging	Het
Rabepk	T	C	2: 34,785,699	T140A	probably benign	Het
Ranbp2	G	T	10: 58,463,906	R454L	probably damaging	Het
Rnf123	C	T	9: 108,058,536	R943Q	probably null	Het
Sash1	G	A	10: 8,729,717	R970*	probably null	Het
Serpinb2	C	A	1: 107,524,692	F333L	probably damaging	Het
Shank3	T	A	15: 89,503,525		probably null	Het
Slc9a2	A	C	1: 40,726,379	I310L	probably damaging	Het
Strip2	T	A	6: 29,920,533		probably null	Het
Thoc3	T	C	13: 54,463,752	T241A	probably damaging	Het
Tmem139	T	A	6: 42,263,265	V2E	probably damaging	Het
Usp24	G	T	4: 106,387,546	V1233F	probably damaging	Het
Vnn1	A	G	10: 23,900,747	Q332R	probably benign	Het
Wac	T	A	18: 7,921,455	H530Q	probably damaging	Het
Wdr35	T	A	12: 8,978,659	N92K	probably benign	Het
Zbtb18	T	G	1: 177,447,254	L60R	probably damaging	Het
Zfp184	T	A	13: 21,959,992	C623S	probably damaging	Het
Zfp292	A	G	4: 34,806,796	Y2088H	probably damaging	Het
Zfp975	G	T	7: 42,662,672	S172R	probably benign	Het
Zswim2	G	A	2: 83,915,727	Q456*	probably null	Het

Other mutations in Cntnap5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Cntnap5b	APN	1	100050754	missense	probably damaging	1.00
IGL00477:Cntnap5b	APN	1	100213743	missense	probably damaging	0.97
IGL00505:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00596:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00846:Cntnap5b	APN	1	100164223	missense	probably damaging	1.00
IGL00895:Cntnap5b	APN	1	100383585	missense	probably damaging	0.98
IGL00948:Cntnap5b	APN	1	100141357	missense	probably benign	0.00
IGL01073:Cntnap5b	APN	1	100076030	missense	probably benign	0.08
IGL01523:Cntnap5b	APN	1	100431779	missense	probably benign	0.02
IGL01779:Cntnap5b	APN	1	99967339	missense	probably damaging	1.00
IGL02253:Cntnap5b	APN	1	100164211	missense	possibly damaging	0.75
IGL02628:Cntnap5b	APN	1	100072069	missense	probably damaging	0.97
R0166:Cntnap5b	UTSW	1	100274361	missense	probably benign	0.41
R0211:Cntnap5b	UTSW	1	100478374	missense	possibly damaging	0.82
R0281:Cntnap5b	UTSW	1	100072153	missense	probably benign	0.22
R0363:Cntnap5b	UTSW	1	100274468	missense	probably benign	0.01
R0514:Cntnap5b	UTSW	1	99772786	missense	probably benign
R0645:Cntnap5b	UTSW	1	100072042	splice site	probably benign
R0848:Cntnap5b	UTSW	1	100255163	missense	probably benign	0.22
R1006:Cntnap5b	UTSW	1	100383617	missense	probably benign	0.00
R1349:Cntnap5b	UTSW	1	100164088	missense	probably benign	0.09
R1372:Cntnap5b	UTSW	1	100164088	missense	probably benign	0.09
R1474:Cntnap5b	UTSW	1	100072089	missense	probably benign	0.25
R1681:Cntnap5b	UTSW	1	100076107	missense	probably damaging	0.98
R1727:Cntnap5b	UTSW	1	100213744	missense	possibly damaging	0.91
R1760:Cntnap5b	UTSW	1	99772810	missense	probably benign	0.05
R1777:Cntnap5b	UTSW	1	100370078	missense	probably benign	0.10
R1939:Cntnap5b	UTSW	1	99967348	missense	probably benign
R1988:Cntnap5b	UTSW	1	100072140	missense	possibly damaging	0.92
R2069:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R2113:Cntnap5b	UTSW	1	100274415	missense	probably benign
R2148:Cntnap5b	UTSW	1	100383474	missense	probably benign	0.01
R2158:Cntnap5b	UTSW	1	100390572	missense	probably damaging	1.00
R2223:Cntnap5b	UTSW	1	100213687	missense	probably damaging	1.00
R2350:Cntnap5b	UTSW	1	100379126	missense	probably damaging	1.00
R3840:Cntnap5b	UTSW	1	100383477	missense	possibly damaging	0.50
R4329:Cntnap5b	UTSW	1	100072163	missense	probably damaging	0.99
R4609:Cntnap5b	UTSW	1	99772847	critical splice donor site	probably null
R4799:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R5129:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R5323:Cntnap5b	UTSW	1	100383550	nonsense	probably null
R5434:Cntnap5b	UTSW	1	100072201	missense	probably benign	0.02
R5579:Cntnap5b	UTSW	1	100383395	nonsense	probably null
R5579:Cntnap5b	UTSW	1	100383399	missense	probably benign	0.27
R5630:Cntnap5b	UTSW	1	100072069	missense	probably damaging	0.99
R5644:Cntnap5b	UTSW	1	100383601	missense	probably benign	0.00
R5761:Cntnap5b	UTSW	1	100446894	missense	probably damaging	1.00
R6042:Cntnap5b	UTSW	1	100390592	missense	probably benign
R6147:Cntnap5b	UTSW	1	100050781	missense	probably damaging	1.00
R6190:Cntnap5b	UTSW	1	100379075	missense	possibly damaging	0.80
R6248:Cntnap5b	UTSW	1	100072102	missense	probably benign	0.30
R6286:Cntnap5b	UTSW	1	100255073	missense	possibly damaging	0.82
R6306:Cntnap5b	UTSW	1	100164146	missense	probably damaging	1.00
R6336:Cntnap5b	UTSW	1	100358669	missense	probably benign	0.00
R6360:Cntnap5b	UTSW	1	100431736	nonsense	probably null
R6722:Cntnap5b	UTSW	1	100478486	missense	probably damaging	0.98
R6750:Cntnap5b	UTSW	1	100274499	missense	probably damaging	1.00
R6806:Cntnap5b	UTSW	1	99940649	missense	probably damaging	1.00
R6933:Cntnap5b	UTSW	1	100383450	missense	probably benign	0.01
R6957:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6958:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6959:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6961:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6962:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R7146:Cntnap5b	UTSW	1	100050794	splice site	probably null
R7165:Cntnap5b	UTSW	1	100076162	missense	possibly damaging	0.94
R7190:Cntnap5b	UTSW	1	100431849	splice site	probably null
R7376:Cntnap5b	UTSW	1	99967269	missense	possibly damaging	0.92
R7385:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R8053:Cntnap5b	UTSW	1	100390677	missense	probably damaging	0.98
R8080:Cntnap5b	UTSW	1	100072203	missense	probably benign	0.16
R8082:Cntnap5b	UTSW	1	100379216	missense	probably benign	0.00
R8271:Cntnap5b	UTSW	1	100072107	missense	probably benign	0.00
R8303:Cntnap5b	UTSW	1	100141297	missense	probably damaging	1.00
R8428:Cntnap5b	UTSW	1	100383585	missense	probably damaging	0.98
R9131:Cntnap5b	UTSW	1	100050643	missense	probably benign	0.22
R9144:Cntnap5b	UTSW	1	100050787	missense	probably damaging	1.00
R9522:Cntnap5b	UTSW	1	100484622	missense	probably benign	0.00
R9611:Cntnap5b	UTSW	1	99967210	missense	probably damaging	1.00
RF007:Cntnap5b	UTSW	1	100164070	missense	probably damaging	1.00
X0020:Cntnap5b	UTSW	1	100431848	critical splice donor site	probably null
Z1176:Cntnap5b	UTSW	1	99967270	missense	probably damaging	0.99
Z1176:Cntnap5b	UTSW	1	100164228	missense	possibly damaging	0.86
Z1176:Cntnap5b	UTSW	1	100446840	missense	probably benign	0.01
Z1177:Cntnap5b	UTSW	1	100050706	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCAGCCACCCATGACTATTC -3'
(R):5'- AAAGCATTGGTTGGAATCGGTTC -3'

Sequencing Primer
(F):5'- TGGCACAGATGTCCAATATTTTG -3'
(R):5'- GAATCGGTTCCTTGCCCC -3'

Posted On

2019-05-15