Incidental Mutation 'R7088:Pear1'
ID549991
Institutional Source Beutler Lab
Gene Symbol Pear1
Ensembl Gene ENSMUSG00000028073
Gene Nameplatelet endothelial aggregation receptor 1
SynonymsJedi-1, 3110045G13Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001032413.1, NM_001032414.1, NM_028460.2, NM_152799.2; MGI:1920432

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87747890-87824306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87754638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 477 (V477F)
Ref Sequence ENSEMBL: ENSMUSP00000133474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029714] [ENSMUST00000079083] [ENSMUST00000090981] [ENSMUST00000172590] [ENSMUST00000172621] [ENSMUST00000173184] [ENSMUST00000173225] [ENSMUST00000173468] [ENSMUST00000174219] [ENSMUST00000174267] [ENSMUST00000174713] [ENSMUST00000174759] [ENSMUST00000174776]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029714
AA Change: V477F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073
AA Change: V477F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079083
AA Change: V477F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078090
Gene: ENSMUSG00000028073
AA Change: V477F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090981
AA Change: V477F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073
AA Change: V477F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172590
SMART Domains Protein: ENSMUSP00000133480
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
Blast:EGF 23 50 8e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172621
AA Change: V477F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133474
Gene: ENSMUSG00000028073
AA Change: V477F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172669
SMART Domains Protein: ENSMUSP00000134451
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF_like 1 34 1.85e0 SMART
EGF 33 65 3.1e-2 SMART
EGF 76 108 2.53e1 SMART
transmembrane domain 128 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173184
SMART Domains Protein: ENSMUSP00000134100
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 95 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173225
SMART Domains Protein: ENSMUSP00000134387
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173468
SMART Domains Protein: ENSMUSP00000133988
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 2.1e-16 PFAM
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF 184 215 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174219
SMART Domains Protein: ENSMUSP00000133565
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
EGF 15 47 4.03e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174267
SMART Domains Protein: ENSMUSP00000133626
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174713
SMART Domains Protein: ENSMUSP00000134215
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174759
AA Change: V477F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133323
Gene: ENSMUSG00000028073
AA Change: V477F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174776
SMART Domains Protein: ENSMUSP00000133749
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:EMI 23 96 6.3e-17 PFAM
Blast:FU 97 120 1e-5 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PEAR1 is a platelet receptor that signals upon the formation of platelet-platelet contacts independent of platelet activation and secondary to platelet aggregation (Nanda et al., 2005 [PubMed 15851471]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent defects in hemostasis or thrombus formation. Although in vitro dextran sulfate-induced platelet aggregation is impaired, platelet aggregation initiated with physiological agonists is normal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Pear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Pear1 APN 3 87752116 missense possibly damaging 0.65
IGL01810:Pear1 APN 3 87752301 missense probably damaging 0.98
IGL02269:Pear1 APN 3 87756264 missense probably damaging 1.00
IGL02635:Pear1 APN 3 87750146 makesense probably null
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0040:Pear1 UTSW 3 87754358 missense probably damaging 0.99
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0050:Pear1 UTSW 3 87755987 nonsense probably null
R0090:Pear1 UTSW 3 87754342 missense possibly damaging 0.82
R0547:Pear1 UTSW 3 87788800 intron probably null
R1024:Pear1 UTSW 3 87760299 unclassified probably benign
R1612:Pear1 UTSW 3 87751853 critical splice donor site probably null
R1637:Pear1 UTSW 3 87756753 missense probably damaging 0.97
R1772:Pear1 UTSW 3 87754492 unclassified probably benign
R1888:Pear1 UTSW 3 87810575 splice site probably benign
R2129:Pear1 UTSW 3 87758359 nonsense probably null
R2255:Pear1 UTSW 3 87752186 missense probably damaging 1.00
R3551:Pear1 UTSW 3 87758132 missense probably benign
R3855:Pear1 UTSW 3 87751921 missense possibly damaging 0.94
R4021:Pear1 UTSW 3 87756222 missense possibly damaging 0.89
R4546:Pear1 UTSW 3 87754661 missense probably damaging 1.00
R5364:Pear1 UTSW 3 87758361 missense probably damaging 1.00
R5447:Pear1 UTSW 3 87759142 missense probably damaging 1.00
R5504:Pear1 UTSW 3 87752695 splice site probably benign
R6026:Pear1 UTSW 3 87756913 missense probably damaging 1.00
R6061:Pear1 UTSW 3 87755931 missense probably benign 0.02
R6155:Pear1 UTSW 3 87759568 missense probably damaging 0.97
R6175:Pear1 UTSW 3 87752133 missense possibly damaging 0.93
R6339:Pear1 UTSW 3 87752520 missense probably damaging 1.00
R6385:Pear1 UTSW 3 87754199 missense probably benign 0.00
R6715:Pear1 UTSW 3 87759117 missense probably damaging 1.00
R6929:Pear1 UTSW 3 87759565 nonsense probably null
R7097:Pear1 UTSW 3 87751445 missense probably benign 0.00
R7229:Pear1 UTSW 3 87750289 missense probably benign 0.00
R7334:Pear1 UTSW 3 87750225 missense probably damaging 1.00
R7526:Pear1 UTSW 3 87752568 missense probably damaging 0.99
X0063:Pear1 UTSW 3 87754072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCTAGTCAGATTGTGG -3'
(R):5'- ATACTCAGGTGGGCTGGCAG -3'

Sequencing Primer
(F):5'- GGTGTTGTGTTTGCCTTTCCCTC -3'
(R):5'- CGGCCAGGTGGGGTAGAAG -3'
Posted On2019-05-15