Incidental Mutation 'R7088:Usp24'
ID 549995
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7088 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 106387546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1233 (V1233F)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably damaging
Transcript: ENSMUST00000094933
AA Change: V1232F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: V1232F

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165709
AA Change: V1233F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: V1233F

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R8992:Usp24 UTSW 4 106377565 missense probably benign 0.36
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9653:Usp24 UTSW 4 106347367 missense probably benign 0.03
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCCCAATAGAATGTGGCACTC -3'
(R):5'- TGGCATTGTCTGTCCAACAAG -3'

Sequencing Primer
(F):5'- ACTTTGTGCAGATGAGACCC -3'
(R):5'- GCATTGTCTGTCCAACAAGTAAAAAC -3'
Posted On 2019-05-15