Incidental Mutation 'R7088:Strip2'
ID550001
Institutional Source Beutler Lab
Gene Symbol Strip2
Ensembl Gene ENSMUSG00000039629
Gene Namestriatin interacting protein 2
SynonymsFam40b, D330017J20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177204.3, NM_001037740.1; Ensembl: ENSMUST00000046028

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29917012-29959681 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 29920533 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046028] [ENSMUST00000115224] [ENSMUST00000151738]
Predicted Effect probably null
Transcript: ENSMUST00000046028
SMART Domains Protein: ENSMUSP00000036477
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 822 4.98e-199 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115224
SMART Domains Protein: ENSMUSP00000110879
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 662 4.85e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151738
SMART Domains Protein: ENSMUSP00000119506
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 794 1.72e-161 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Strip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Strip2 APN 6 29931214 missense probably benign 0.04
IGL01357:Strip2 APN 6 29939167 splice site probably benign
IGL01636:Strip2 APN 6 29931193 missense probably benign 0.06
IGL01959:Strip2 APN 6 29928554 missense probably damaging 0.99
IGL01961:Strip2 APN 6 29928427 splice site probably benign
IGL02089:Strip2 APN 6 29917180 unclassified probably benign
1mM(1):Strip2 UTSW 6 29955631 missense probably damaging 1.00
R0079:Strip2 UTSW 6 29920533 critical splice donor site probably null
R0331:Strip2 UTSW 6 29926560 missense probably benign 0.44
R0367:Strip2 UTSW 6 29937651 missense possibly damaging 0.90
R0592:Strip2 UTSW 6 29931210 missense probably benign 0.28
R1087:Strip2 UTSW 6 29927634 missense probably damaging 0.99
R1390:Strip2 UTSW 6 29929829 missense probably damaging 1.00
R1758:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2213:Strip2 UTSW 6 29931148 missense probably damaging 0.99
R2437:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2900:Strip2 UTSW 6 29939035 critical splice acceptor site probably null
R3892:Strip2 UTSW 6 29917075 unclassified probably benign
R4010:Strip2 UTSW 6 29955585 missense possibly damaging 0.66
R4435:Strip2 UTSW 6 29925050 missense probably benign 0.06
R4807:Strip2 UTSW 6 29925093 nonsense probably null
R5015:Strip2 UTSW 6 29931266 missense probably benign 0.03
R5080:Strip2 UTSW 6 29945593 missense probably damaging 0.99
R5484:Strip2 UTSW 6 29917155 unclassified probably benign
R5502:Strip2 UTSW 6 29927624 missense probably benign 0.23
R5899:Strip2 UTSW 6 29956958 utr 3 prime probably benign
R6004:Strip2 UTSW 6 29926571 missense probably damaging 0.98
R6479:Strip2 UTSW 6 29944497 splice site probably null
R6835:Strip2 UTSW 6 29941917 missense probably damaging 1.00
R7068:Strip2 UTSW 6 29932208 missense probably benign 0.03
R7073:Strip2 UTSW 6 29941912 missense possibly damaging 0.95
R7231:Strip2 UTSW 6 29944487 missense probably damaging 0.96
R7399:Strip2 UTSW 6 29927613 missense possibly damaging 0.94
R7813:Strip2 UTSW 6 29923913 critical splice acceptor site probably null
R7827:Strip2 UTSW 6 29923929 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTGCAGGTCATTGTTTCAGG -3'
(R):5'- TGATCTGAGAGCAAATCAGTGC -3'

Sequencing Primer
(F):5'- GGCCAGAGAAGAATCACATTCCTG -3'
(R):5'- TGCAGCAAAAGAAAAAGAATTACC -3'
Posted On2019-05-15