Incidental Mutation 'R7088:Cd177'
ID550004
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24745133 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 674 (C674*)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably null
Transcript: ENSMUST00000063956
AA Change: C674*
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: C674*

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5415:Cd177 UTSW 7 24752391 missense probably damaging 1.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5731:Cd177 UTSW 7 24744421 missense probably damaging 1.00
R5775:Cd177 UTSW 7 24752268 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6148:Cd177 UTSW 7 24744273 nonsense probably null
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7188:Cd177 UTSW 7 24756647 missense probably damaging 1.00
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
R7744:Cd177 UTSW 7 24750375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACACACATGGGGCACTG -3'
(R):5'- TAGTCTCCCTATGATTGGGAGG -3'

Sequencing Primer
(F):5'- ATGGGGCACTGCACATCTC -3'
(R):5'- ACAAGGCTCCCAGTCCTTGC -3'
Posted On2019-05-15