Incidental Mutation 'R7088:Dhx32'
ID550007
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 32
SynonymsDdx32
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location133720942-133782726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133742688 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 204 (L204Q)
Ref Sequence ENSEMBL: ENSMUSP00000033290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably damaging
Transcript: ENSMUST00000033290
AA Change: L204Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: L204Q

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063669
AA Change: L204Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: L204Q

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106139
AA Change: L64Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986
AA Change: L64Q

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133748977 missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133759525 missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133737421 missense probably benign 0.01
R1054:Dhx32 UTSW 7 133725272 missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133737340 missense possibly damaging 0.87
R1532:Dhx32 UTSW 7 133749024 missense possibly damaging 0.93
R1864:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R1865:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R2074:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2075:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2119:Dhx32 UTSW 7 133722247 nonsense probably null
R2377:Dhx32 UTSW 7 133724478 missense probably damaging 1.00
R3125:Dhx32 UTSW 7 133725356 missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133734109 missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133738655 intron probably benign
R5538:Dhx32 UTSW 7 133723217 missense probably benign
R5616:Dhx32 UTSW 7 133721228 makesense probably null
R5951:Dhx32 UTSW 7 133737328 missense probably damaging 0.98
R6081:Dhx32 UTSW 7 133722212 missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133742800 missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133737226 missense probably damaging 1.00
R7257:Dhx32 UTSW 7 133759477 missense probably benign 0.08
R7686:Dhx32 UTSW 7 133759701 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CCGAGCGGTGGATTTCAAAG -3'
(R):5'- GGGTATACGTGGAGTCCTTTAC -3'

Sequencing Primer
(F):5'- CGTATGACAGACTCGAAGGAATCC -3'
(R):5'- ATACGTGGAGTCCTTTACATGGTG -3'
Posted On2019-05-15