Incidental Mutation 'R7088:Pidd1'
ID550008
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Namep53 induced death domain protein 1
Synonyms1200011D09Rik, Lrdd, Pidd
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141438113-141444025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141440487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 539 (V539E)
Ref Sequence ENSEMBL: ENSMUSP00000101627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000172654] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000201710] [ENSMUST00000201822]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026580
AA Change: V539E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: V539E

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106005
AA Change: V539E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: V539E

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Meta Mutation Damage Score 0.5240 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141439163 missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141443108 missense probably benign 0.00
IGL03083:Pidd1 APN 7 141440456 critical splice donor site probably null
IGL03347:Pidd1 APN 7 141439168 missense probably damaging 0.97
R0329:Pidd1 UTSW 7 141439561 unclassified probably benign
R0426:Pidd1 UTSW 7 141439133 missense probably damaging 1.00
R0650:Pidd1 UTSW 7 141440813 nonsense probably null
R0651:Pidd1 UTSW 7 141440813 nonsense probably null
R1201:Pidd1 UTSW 7 141440274 missense probably benign
R1221:Pidd1 UTSW 7 141438812 missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141440777 missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141439630 missense probably benign
R3967:Pidd1 UTSW 7 141439082 missense possibly damaging 0.86
R4072:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4073:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4075:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141441366 missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141441443 unclassified probably benign
R4700:Pidd1 UTSW 7 141442249 missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141442986 missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141438591 makesense probably null
R5402:Pidd1 UTSW 7 141438594 missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141441111 splice site probably null
R5790:Pidd1 UTSW 7 141441392 unclassified probably benign
R5909:Pidd1 UTSW 7 141441270 missense probably damaging 1.00
R6275:Pidd1 UTSW 7 141439795 missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141439581 missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6872:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6935:Pidd1 UTSW 7 141440302 missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141439900 missense probably benign 0.05
R7544:Pidd1 UTSW 7 141440339 missense possibly damaging 0.81
R7821:Pidd1 UTSW 7 141442280 missense probably benign 0.36
R7861:Pidd1 UTSW 7 141440142 missense probably damaging 1.00
R7903:Pidd1 UTSW 7 141439831 missense probably damaging 0.99
R7944:Pidd1 UTSW 7 141440142 missense probably damaging 1.00
R7986:Pidd1 UTSW 7 141439831 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCATCCCAGGTGGTTGTCAG -3'
(R):5'- AGTCTCCATGCAGGTATTGAC -3'

Sequencing Primer
(F):5'- CAGGGGTGTTCGGTAGAGCAG -3'
(R):5'- CTCCATGCAGGTATTGACAGGGTAG -3'
Posted On2019-05-15