Incidental Mutation 'R7088:Olfr1354'
ID550026
Institutional Source Beutler Lab
Gene Symbol Olfr1354
Ensembl Gene ENSMUSG00000094673
Gene Nameolfactory receptor 1354
SynonymsGA_x6K02T2QGN0-2895081-2894349, EG257869, MOR139-5, MOR185-8, MOR139-7, GA_x6K02T03FR9-4826-3919, Olfr233-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78913171-78920399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 78917759 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 306 (L306F)
Ref Sequence ENSEMBL: ENSMUSP00000144801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075859] [ENSMUST00000204587] [ENSMUST00000217073]
Predicted Effect probably benign
Transcript: ENSMUST00000075859
AA Change: L306F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093126
Gene: ENSMUSG00000094673
AA Change: L306F

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204587
AA Change: L306F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217073
AA Change: L306F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Olfr1354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Olfr1354 APN 10 78917416 missense probably damaging 0.99
IGL02962:Olfr1354 APN 10 78916939 missense probably damaging 1.00
IGL03032:Olfr1354 APN 10 78917637 missense probably benign 0.21
PIT4495001:Olfr1354 UTSW 10 78916987 missense probably benign
R0268:Olfr1354 UTSW 10 78917605 missense probably damaging 0.99
R0359:Olfr1354 UTSW 10 78917343 missense probably benign 0.00
R0382:Olfr1354 UTSW 10 78917126 nonsense probably null
R1895:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R1946:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R2035:Olfr1354 UTSW 10 78917587 missense possibly damaging 0.86
R3853:Olfr1354 UTSW 10 78916947 missense probably damaging 1.00
R4756:Olfr1354 UTSW 10 78917527 missense probably damaging 0.99
R5326:Olfr1354 UTSW 10 78917586 missense possibly damaging 0.86
R5607:Olfr1354 UTSW 10 78917099 missense possibly damaging 0.93
R7070:Olfr1354 UTSW 10 78917268 missense probably benign
R7212:Olfr1354 UTSW 10 78917505 missense possibly damaging 0.81
R7348:Olfr1354 UTSW 10 78917562 missense probably damaging 1.00
R7386:Olfr1354 UTSW 10 78916843 start codon destroyed probably null 0.98
R7847:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
R7930:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAAGGCATTTTCTACATGTGTCTC -3'
(R):5'- ACATGTGTATATTTTAGGCACCCAC -3'

Sequencing Primer
(F):5'- GGCATTTTCTACATGTGTCTCTCACC -3'
(R):5'- AAGGGTGATGCATCCCTTGAATC -3'
Posted On2019-05-15