Incidental Mutation 'R7088:Gli1'
ID550027
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene NameGLI-Kruppel family member GLI1
SynonymsZfp-5, Zfp5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127329882-127341974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127335999 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 295 (M295I)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000218236] [ENSMUST00000219671]
Predicted Effect probably damaging
Transcript: ENSMUST00000026474
AA Change: M295I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: M295I

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218236
Predicted Effect probably benign
Transcript: ENSMUST00000219671
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127332478 missense probably damaging 1.00
IGL01824:Gli1 APN 10 127336527 missense probably benign 0.44
IGL02134:Gli1 APN 10 127336500 missense probably benign 0.00
IGL02508:Gli1 APN 10 127337092 missense probably benign 0.14
IGL02931:Gli1 APN 10 127332410 missense probably benign 0.00
R0099:Gli1 UTSW 10 127336006 missense probably damaging 1.00
R0590:Gli1 UTSW 10 127331563 missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1169:Gli1 UTSW 10 127338451 missense probably damaging 1.00
R1519:Gli1 UTSW 10 127334269 missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1550:Gli1 UTSW 10 127338516 missense probably damaging 1.00
R1592:Gli1 UTSW 10 127331329 missense probably damaging 0.97
R1879:Gli1 UTSW 10 127333737 missense probably damaging 1.00
R1892:Gli1 UTSW 10 127330106 missense possibly damaging 0.82
R1934:Gli1 UTSW 10 127331239 missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R2088:Gli1 UTSW 10 127331500 missense probably damaging 1.00
R2141:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R3803:Gli1 UTSW 10 127338065 splice site probably benign
R3873:Gli1 UTSW 10 127331356 missense probably damaging 1.00
R3874:Gli1 UTSW 10 127330219 missense probably damaging 1.00
R3899:Gli1 UTSW 10 127336666 missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127330855 missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127330262 missense probably benign 0.00
R5686:Gli1 UTSW 10 127337436 missense probably benign 0.01
R5812:Gli1 UTSW 10 127337415 missense probably damaging 1.00
R6053:Gli1 UTSW 10 127334315 missense probably damaging 1.00
R7162:Gli1 UTSW 10 127332437 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGTATGTTCATCTTTCTGTCGA -3'
(R):5'- GGAGCTGCATTCCCCACTCT -3'

Sequencing Primer
(F):5'- CTGTCGATACAGTCTTCAGCGAG -3'
(R):5'- TTATTCCCCCAAGAGGAGAAGCTG -3'
Posted On2019-05-15