Mutagenetix > Incidental Mutation

Incidental Mutation 'R7088:Ptprg'

550041

Institutional Source

Beutler Lab

Gene Symbol

Ptprg

Ensembl Gene

ENSMUSG00000021745

Gene Name

protein tyrosine phosphatase, receptor type, G

Synonyms

5430405N12Rik, RPTPgamma

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11553532-12242041 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12207365 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 878 (I878F)

Ref Sequence

ENSEMBL: ENSMUSP00000022264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022264
AA Change: I878F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: I878F

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	321	6.38e-109	SMART
FN3	347	433	5.4e-7	SMART
low complexity region	474	484	N/A	INTRINSIC
low complexity region	515	525	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC
transmembrane domain	734	756	N/A	INTRINSIC
PTPc	844	1118	1.76e-136	SMART
PTPc	1146	1409	1.32e-85	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119888
AA Change: I103F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: I103F

Domain	Start	End	E-Value	Type
PTPc	69	343	1.76e-136	SMART
PTPc	371	634	1.32e-85	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142917

SMART Domains

Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

Domain	Start	End	E-Value	Type
Carb_anhydrase	60	260	1.6e-50	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
2410089E03Rik	C	T	15: 8,218,947	T1660M	probably benign	Het
5830473C10Rik	T	A	5: 90,572,750	L260*	probably null	Het
Acaca	T	C	11: 84,278,957		probably null	Het
AI314180	A	T	4: 58,849,766	L458I	possibly damaging	Het
Alkbh3	A	G	2: 94,004,752	S83P	possibly damaging	Het
Ammecr1l	T	C	18: 31,771,819	S38P	probably benign	Het
Armc10	T	C	5: 21,653,392	V145A	probably damaging	Het
BC048671	A	G	6: 90,303,240	K46R	probably null	Het
C2cd3	A	G	7: 100,416,181	T347A		Het
C8b	G	T	4: 104,793,343	E449D	probably benign	Het
Camk4	T	C	18: 32,939,531	S46P	probably benign	Het
Ccdc113	G	A	8: 95,538,105	R81H	probably benign	Het
Cd177	A	T	7: 24,745,133	C674*	probably null	Het
Cdc6	T	A	11: 98,919,239	V458D	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Ckap2	G	T	8: 22,169,866	P533Q	possibly damaging	Het
Cma1	T	A	14: 55,943,816	H44L	probably damaging	Het
Cmya5	A	T	13: 93,091,864	S2239T	possibly damaging	Het
Cntnap5b	T	A	1: 100,160,077	I141N	probably damaging	Het
Col6a4	T	A	9: 106,000,686	T2031S	possibly damaging	Het
Cxcr5	T	A	9: 44,513,386	T325S	possibly damaging	Het
Dhx32	A	T	7: 133,742,688	L204Q	probably damaging	Het
Dse	A	G	10: 34,153,889	Y402H	probably damaging	Het
Exoc6	G	T	19: 37,577,010	C178F	probably damaging	Het
Fam149a	A	G	8: 45,350,545	V384A	probably benign	Het
Fcrl5	T	C	3: 87,457,834	*597Q	probably null	Het
Fer1l6	A	G	15: 58,564,050	K431E	possibly damaging	Het
Fmo3	T	A	1: 162,968,865	H46L	probably benign	Het
Gcm2	T	C	13: 41,103,364	D303G	probably damaging	Het
Gk2	T	C	5: 97,455,675	M435V	probably damaging	Het
Gli1	C	A	10: 127,335,999	M295I	probably damaging	Het
Gm11444	G	T	11: 85,847,036	H109Q		Het
Gtpbp1	T	A	15: 79,719,282	D182E		Het
Hnf4g	A	T	3: 3,648,125		probably null	Het
Hsf2	G	A	10: 57,512,092	R483H	probably damaging	Het
Kcnq4	C	T	4: 120,704,399	R491H	probably damaging	Het
Lama3	T	C	18: 12,582,545	V1686A	possibly damaging	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Mboat1	T	G	13: 30,195,789		probably null	Het
Mdh1	T	C	11: 21,558,484	Y286C	probably damaging	Het
Mga	G	T	2: 119,961,936	K2607N	probably damaging	Het
Morf4l1	C	A	9: 90,097,380	V183F	possibly damaging	Het
Mroh4	G	A	15: 74,626,144	R196W	probably benign	Het
Muc16	C	A	9: 18,592,680	M6438I	probably damaging	Het
Myom3	A	G	4: 135,803,278	Y1167C	probably damaging	Het
Neurl3	T	C	1: 36,269,221	E170G	possibly damaging	Het
Nsd3	T	C	8: 25,666,034	I539T	probably benign	Het
Nup155	T	C	15: 8,156,693	F1313S	probably benign	Het
Nxn	A	T	11: 76,263,148	V287E	possibly damaging	Het
Olfr1253	G	A	2: 89,752,099	T243I	probably benign	Het
Olfr1354	A	C	10: 78,917,759	L306F	probably benign	Het
Olfr891	C	A	9: 38,180,452	V124F	probably damaging	Het
Pax6	A	G	2: 105,696,408	N220D	probably benign	Het
Pcdha11	G	A	18: 37,005,417	R33H	probably benign	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pear1	C	A	3: 87,754,638	V477F	possibly damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pidd1	A	T	7: 141,440,487	V539E	probably damaging	Het
Rabepk	T	C	2: 34,785,699	T140A	probably benign	Het
Ranbp2	G	T	10: 58,463,906	R454L	probably damaging	Het
Rnf123	C	T	9: 108,058,536	R943Q	probably null	Het
Sash1	G	A	10: 8,729,717	R970*	probably null	Het
Serpinb2	C	A	1: 107,524,692	F333L	probably damaging	Het
Shank3	T	A	15: 89,503,525		probably null	Het
Slc9a2	A	C	1: 40,726,379	I310L	probably damaging	Het
Strip2	T	A	6: 29,920,533		probably null	Het
Thoc3	T	C	13: 54,463,752	T241A	probably damaging	Het
Tmem139	T	A	6: 42,263,265	V2E	probably damaging	Het
Usp24	G	T	4: 106,387,546	V1233F	probably damaging	Het
Vnn1	A	G	10: 23,900,747	Q332R	probably benign	Het
Wac	T	A	18: 7,921,455	H530Q	probably damaging	Het
Wdr35	T	A	12: 8,978,659	N92K	probably benign	Het
Zbtb18	T	G	1: 177,447,254	L60R	probably damaging	Het
Zfp184	T	A	13: 21,959,992	C623S	probably damaging	Het
Zfp292	A	G	4: 34,806,796	Y2088H	probably damaging	Het
Zfp975	G	T	7: 42,662,672	S172R	probably benign	Het
Zswim2	G	A	2: 83,915,727	Q456*	probably null	Het

Other mutations in Ptprg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Ptprg	APN	14	12215992	missense	probably damaging	1.00
IGL00484:Ptprg	APN	14	12215220	missense	probably damaging	0.99
IGL00847:Ptprg	APN	14	12215265	missense	probably damaging	1.00
IGL01089:Ptprg	APN	14	12215286	missense	probably damaging	0.97
IGL01382:Ptprg	APN	14	12237797	missense	probably benign	0.16
IGL01470:Ptprg	APN	14	12213702	nonsense	probably null
IGL01762:Ptprg	APN	14	12037386	missense	probably benign	0.00
IGL01886:Ptprg	APN	14	12179280	missense	probably benign	0.22
IGL01963:Ptprg	APN	14	12220661	missense	probably damaging	1.00
IGL02015:Ptprg	APN	14	12237782	missense	possibly damaging	0.46
IGL02086:Ptprg	APN	14	12110080	nonsense	probably null
IGL02197:Ptprg	APN	14	12220613	missense	probably damaging	0.98
IGL02341:Ptprg	APN	14	12154360	missense	probably benign	0.00
IGL02732:Ptprg	APN	14	12225617	critical splice donor site	probably null
IGL03011:Ptprg	APN	14	12219029	missense	probably damaging	1.00
IGL03261:Ptprg	APN	14	12225552	missense	probably damaging	0.99
R0038:Ptprg	UTSW	14	12213710	missense	probably damaging	1.00
R0383:Ptprg	UTSW	14	12219024	missense	possibly damaging	0.93
R0433:Ptprg	UTSW	14	12220620	missense	probably damaging	1.00
R0488:Ptprg	UTSW	14	12220653	missense	probably damaging	1.00
R0503:Ptprg	UTSW	14	12237138	missense	possibly damaging	0.89
R0520:Ptprg	UTSW	14	12199783	missense	possibly damaging	0.92
R0570:Ptprg	UTSW	14	12215896	missense	probably damaging	1.00
R0606:Ptprg	UTSW	14	12154131	missense	probably benign
R1086:Ptprg	UTSW	14	11952706	splice site	probably benign
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1468:Ptprg	UTSW	14	12190767	missense	probably benign	0.02
R1519:Ptprg	UTSW	14	12220596	missense	probably damaging	1.00
R1662:Ptprg	UTSW	14	12207357	missense	probably damaging	1.00
R1714:Ptprg	UTSW	14	12213697	missense	probably damaging	1.00
R1716:Ptprg	UTSW	14	12154360	missense	probably benign	0.00
R1797:Ptprg	UTSW	14	12199743	missense	probably damaging	1.00
R1803:Ptprg	UTSW	14	12091410	splice site	probably null
R2104:Ptprg	UTSW	14	11952897	critical splice donor site	probably null
R2125:Ptprg	UTSW	14	12179283	missense	possibly damaging	0.74
R2126:Ptprg	UTSW	14	12154355	missense	probably benign
R2133:Ptprg	UTSW	14	12211637	missense	probably damaging	1.00
R2471:Ptprg	UTSW	14	12210327	missense	probably damaging	1.00
R2571:Ptprg	UTSW	14	12122135	missense	probably benign
R3821:Ptprg	UTSW	14	12226375	missense	probably benign	0.00
R4196:Ptprg	UTSW	14	12122002	missense	possibly damaging	0.51
R4392:Ptprg	UTSW	14	12142467	missense	possibly damaging	0.80
R4665:Ptprg	UTSW	14	12215288	missense	possibly damaging	0.90
R4730:Ptprg	UTSW	14	12213713	missense	probably damaging	1.00
R4737:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R4764:Ptprg	UTSW	14	12122068	missense	probably benign	0.01
R4801:Ptprg	UTSW	14	11554233	utr 5 prime	probably benign
R4825:Ptprg	UTSW	14	12220654	missense	probably damaging	1.00
R4960:Ptprg	UTSW	14	12237837	missense	probably benign	0.07
R4972:Ptprg	UTSW	14	12226427	missense	possibly damaging	0.94
R4980:Ptprg	UTSW	14	12154421	missense	probably benign	0.16
R5004:Ptprg	UTSW	14	12220667	missense	probably damaging	1.00
R5058:Ptprg	UTSW	14	12037387	missense	possibly damaging	0.82
R5182:Ptprg	UTSW	14	12154174	missense	probably benign
R5258:Ptprg	UTSW	14	12142431	missense	probably benign	0.11
R5338:Ptprg	UTSW	14	12154111	missense	probably benign
R5353:Ptprg	UTSW	14	11554235	utr 5 prime	probably benign
R5373:Ptprg	UTSW	14	12213665	missense	probably benign	0.00
R5387:Ptprg	UTSW	14	12153873	missense	probably damaging	1.00
R5616:Ptprg	UTSW	14	12122120	missense	probably benign
R5623:Ptprg	UTSW	14	12153857	missense	probably damaging	1.00
R5976:Ptprg	UTSW	14	12211625	missense	probably damaging	0.96
R6027:Ptprg	UTSW	14	12220613	missense	possibly damaging	0.87
R6091:Ptprg	UTSW	14	12215979	missense	probably damaging	1.00
R6184:Ptprg	UTSW	14	12153943	missense	probably benign	0.00
R6234:Ptprg	UTSW	14	12213747	missense	probably damaging	1.00
R6318:Ptprg	UTSW	14	12237118	missense	probably damaging	1.00
R6324:Ptprg	UTSW	14	12226314	missense	probably damaging	1.00
R6334:Ptprg	UTSW	14	12166832	missense	probably damaging	1.00
R6646:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6647:Ptprg	UTSW	14	11962714	missense	probably damaging	1.00
R6992:Ptprg	UTSW	14	11962602	missense	probably damaging	1.00
R7250:Ptprg	UTSW	14	12166767	missense	probably benign	0.18
R7342:Ptprg	UTSW	14	12237151	missense	possibly damaging	0.90
R7358:Ptprg	UTSW	14	12154198	missense	possibly damaging	0.59
R7410:Ptprg	UTSW	14	11962657	missense	probably damaging	1.00
R7448:Ptprg	UTSW	14	12142461	missense	probably benign	0.12
R7514:Ptprg	UTSW	14	12179342	missense	possibly damaging	0.86
R7523:Ptprg	UTSW	14	12237130	missense	probably damaging	0.97
R7672:Ptprg	UTSW	14	12211668	missense	probably benign	0.04
R7709:Ptprg	UTSW	14	12226452	missense	probably damaging	1.00
R7720:Ptprg	UTSW	14	12211703	missense	probably benign	0.31
R8860:Ptprg	UTSW	14	12213685	missense	probably damaging	1.00
R8992:Ptprg	UTSW	14	12154170	missense	probably benign	0.00
R9054:Ptprg	UTSW	14	12213638	missense	possibly damaging	0.58
R9587:Ptprg	UTSW	14	12215992	missense	probably damaging	1.00
R9621:Ptprg	UTSW	14	12237809	missense	probably benign
R9625:Ptprg	UTSW	14	12152027	missense	probably damaging	1.00
R9773:Ptprg	UTSW	14	12199806	missense	probably damaging	0.97
X0020:Ptprg	UTSW	14	12110070	frame shift	probably null
X0027:Ptprg	UTSW	14	12110070	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CATGCTTCAGCCACAGTGTG -3'
(R):5'- GAACATACATCCTCTGGCTCTCAC -3'

Sequencing Primer
(F):5'- CACAGTGTGGTCTTAGAGAACTAC -3'
(R):5'- CTCACTTCATCCCATCACAGG -3'

Posted On

2019-05-15