Incidental Mutation 'R7088:Fer1l6'
ID 550045
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1 like family member 6
Synonyms EG631797
MMRRC Submission 045182-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7088 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58381897-58536936 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58435899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 431 (K431E)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: K431E

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: K431E

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,331,232 (GRCm39) E48* probably null Het
Acaca T C 11: 84,169,783 (GRCm39) probably null Het
Albfm1 T A 5: 90,720,609 (GRCm39) L260* probably null Het
Alkbh3 A G 2: 93,835,097 (GRCm39) S83P possibly damaging Het
Ammecr1l T C 18: 31,904,872 (GRCm39) S38P probably benign Het
Armc10 T C 5: 21,858,390 (GRCm39) V145A probably damaging Het
BC048671 A G 6: 90,280,222 (GRCm39) K46R probably null Het
C2cd3 A G 7: 100,065,388 (GRCm39) T347A Het
C8b G T 4: 104,650,540 (GRCm39) E449D probably benign Het
Camk4 T C 18: 33,072,584 (GRCm39) S46P probably benign Het
Ccdc113 G A 8: 96,264,733 (GRCm39) R81H probably benign Het
Cd177 A T 7: 24,444,558 (GRCm39) C674* probably null Het
Cdc6 T A 11: 98,810,065 (GRCm39) V458D probably damaging Het
Cenpo C T 12: 4,265,307 (GRCm39) E238K probably benign Het
Ckap2 G T 8: 22,659,882 (GRCm39) P533Q possibly damaging Het
Cma1 T A 14: 56,181,273 (GRCm39) H44L probably damaging Het
Cmya5 A T 13: 93,228,372 (GRCm39) S2239T possibly damaging Het
Cntnap5b T A 1: 100,087,802 (GRCm39) I141N probably damaging Het
Col6a4 T A 9: 105,877,885 (GRCm39) T2031S possibly damaging Het
Cplane1 C T 15: 8,248,431 (GRCm39) T1660M probably benign Het
Cxcr5 T A 9: 44,424,683 (GRCm39) T325S possibly damaging Het
Dhx32 A T 7: 133,344,417 (GRCm39) L204Q probably damaging Het
Dse A G 10: 34,029,885 (GRCm39) Y402H probably damaging Het
Ecpas A T 4: 58,849,766 (GRCm39) L458I possibly damaging Het
Exoc6 G T 19: 37,565,458 (GRCm39) C178F probably damaging Het
Fam149a A G 8: 45,803,582 (GRCm39) V384A probably benign Het
Fcrl5 T C 3: 87,365,141 (GRCm39) *597Q probably null Het
Fmo3 T A 1: 162,796,434 (GRCm39) H46L probably benign Het
Gcm2 T C 13: 41,256,840 (GRCm39) D303G probably damaging Het
Gk2 T C 5: 97,603,534 (GRCm39) M435V probably damaging Het
Gli1 C A 10: 127,171,868 (GRCm39) M295I probably damaging Het
Gm11444 G T 11: 85,737,862 (GRCm39) H109Q Het
Gtpbp1 T A 15: 79,603,483 (GRCm39) D182E Het
Hnf4g A T 3: 3,713,185 (GRCm39) probably null Het
Hsf2 G A 10: 57,388,188 (GRCm39) R483H probably damaging Het
Kcnq4 C T 4: 120,561,596 (GRCm39) R491H probably damaging Het
Lama3 T C 18: 12,715,602 (GRCm39) V1686A possibly damaging Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Mboat1 T G 13: 30,379,772 (GRCm39) probably null Het
Mdh1 T C 11: 21,508,484 (GRCm39) Y286C probably damaging Het
Mga G T 2: 119,792,417 (GRCm39) K2607N probably damaging Het
Morf4l1 C A 9: 89,979,433 (GRCm39) V183F possibly damaging Het
Mroh4 G A 15: 74,497,993 (GRCm39) R196W probably benign Het
Muc16 C A 9: 18,503,976 (GRCm39) M6438I probably damaging Het
Myom3 A G 4: 135,530,589 (GRCm39) Y1167C probably damaging Het
Neurl3 T C 1: 36,308,302 (GRCm39) E170G possibly damaging Het
Nsd3 T C 8: 26,156,050 (GRCm39) I539T probably benign Het
Nup155 T C 15: 8,186,177 (GRCm39) F1313S probably benign Het
Nxn A T 11: 76,153,974 (GRCm39) V287E possibly damaging Het
Or4a80 G A 2: 89,582,443 (GRCm39) T243I probably benign Het
Or7a38 A C 10: 78,753,593 (GRCm39) L306F probably benign Het
Or8c13 C A 9: 38,091,748 (GRCm39) V124F probably damaging Het
Pax6 A G 2: 105,526,753 (GRCm39) N220D probably benign Het
Pcdha11 G A 18: 37,138,470 (GRCm39) R33H probably benign Het
Pdzd8 A G 19: 59,333,389 (GRCm39) F211L probably damaging Het
Pear1 C A 3: 87,661,945 (GRCm39) V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pidd1 A T 7: 141,020,400 (GRCm39) V539E probably damaging Het
Ptprg A T 14: 12,207,365 (GRCm38) I878F probably damaging Het
Rabepk T C 2: 34,675,711 (GRCm39) T140A probably benign Het
Ranbp2 G T 10: 58,299,728 (GRCm39) R454L probably damaging Het
Rnf123 C T 9: 107,935,735 (GRCm39) R943Q probably null Het
Sash1 G A 10: 8,605,481 (GRCm39) R970* probably null Het
Serpinb2 C A 1: 107,452,422 (GRCm39) F333L probably damaging Het
Shank3 T A 15: 89,387,728 (GRCm39) probably null Het
Slc9a2 A C 1: 40,765,539 (GRCm39) I310L probably damaging Het
Strip2 T A 6: 29,920,532 (GRCm39) probably null Het
Thoc3 T C 13: 54,611,565 (GRCm39) T241A probably damaging Het
Tmem139 T A 6: 42,240,199 (GRCm39) V2E probably damaging Het
Usp24 G T 4: 106,244,743 (GRCm39) V1233F probably damaging Het
Vnn1 A G 10: 23,776,645 (GRCm39) Q332R probably benign Het
Wac T A 18: 7,921,455 (GRCm39) H530Q probably damaging Het
Wdr35 T A 12: 9,028,659 (GRCm39) N92K probably benign Het
Zbtb18 T G 1: 177,274,820 (GRCm39) L60R probably damaging Het
Zfp184 T A 13: 22,144,162 (GRCm39) C623S probably damaging Het
Zfp292 A G 4: 34,806,796 (GRCm39) Y2088H probably damaging Het
Zfp975 G T 7: 42,312,096 (GRCm39) S172R probably benign Het
Zswim2 G A 2: 83,746,071 (GRCm39) Q456* probably null Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58,534,636 (GRCm39) missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58,430,251 (GRCm39) missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58,509,763 (GRCm39) splice site probably null
R0304:Fer1l6 UTSW 15 58,462,411 (GRCm39) missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58,420,187 (GRCm39) missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58,509,943 (GRCm39) critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58,430,257 (GRCm39) splice site probably null
R0602:Fer1l6 UTSW 15 58,449,794 (GRCm39) missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58,534,784 (GRCm39) splice site probably null
R0669:Fer1l6 UTSW 15 58,425,573 (GRCm39) splice site probably null
R0854:Fer1l6 UTSW 15 58,431,037 (GRCm39) missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58,435,924 (GRCm39) missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R1483:Fer1l6 UTSW 15 58,509,819 (GRCm39) missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58,513,728 (GRCm39) missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58,518,930 (GRCm39) missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58,429,718 (GRCm39) missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58,497,080 (GRCm39) missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58,474,160 (GRCm39) splice site probably benign
R2041:Fer1l6 UTSW 15 58,430,155 (GRCm39) missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2145:Fer1l6 UTSW 15 58,499,383 (GRCm39) missense probably benign
R2981:Fer1l6 UTSW 15 58,435,926 (GRCm39) missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58,431,087 (GRCm39) missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58,518,998 (GRCm39) missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58,499,371 (GRCm39) missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58,498,129 (GRCm39) critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58,512,075 (GRCm39) missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58,425,554 (GRCm39) missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58,512,060 (GRCm39) missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58,449,798 (GRCm39) missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58,490,751 (GRCm39) missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58,509,869 (GRCm39) missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58,472,160 (GRCm39) critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58,443,250 (GRCm39) missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58,515,769 (GRCm39) missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58,512,003 (GRCm39) missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58,422,126 (GRCm39) missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58,453,752 (GRCm39) nonsense probably null
R5561:Fer1l6 UTSW 15 58,532,674 (GRCm39) missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58,430,175 (GRCm39) missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58,494,331 (GRCm39) missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58,443,238 (GRCm39) missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58,462,399 (GRCm39) nonsense probably null
R5823:Fer1l6 UTSW 15 58,462,352 (GRCm39) nonsense probably null
R5892:Fer1l6 UTSW 15 58,435,917 (GRCm39) missense probably benign
R6006:Fer1l6 UTSW 15 58,518,893 (GRCm39) missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58,431,055 (GRCm39) missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58,509,806 (GRCm39) missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58,432,488 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,509,855 (GRCm39) missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58,497,026 (GRCm39) nonsense probably null
R6271:Fer1l6 UTSW 15 58,513,767 (GRCm39) missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58,431,081 (GRCm39) nonsense probably null
R6784:Fer1l6 UTSW 15 58,443,275 (GRCm39) missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58,466,727 (GRCm39) missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58,501,227 (GRCm39) missense probably damaging 1.00
R7181:Fer1l6 UTSW 15 58,447,146 (GRCm39) missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58,462,384 (GRCm39) missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58,499,446 (GRCm39) missense probably benign
R7463:Fer1l6 UTSW 15 58,445,450 (GRCm39) nonsense probably null
R7464:Fer1l6 UTSW 15 58,445,096 (GRCm39) splice site probably null
R7469:Fer1l6 UTSW 15 58,462,419 (GRCm39) splice site probably null
R7483:Fer1l6 UTSW 15 58,513,794 (GRCm39) missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58,472,281 (GRCm39) missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58,509,875 (GRCm39) missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58,432,331 (GRCm39) missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58,430,245 (GRCm39) missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58,499,438 (GRCm39) missense probably benign
R7607:Fer1l6 UTSW 15 58,534,581 (GRCm39) nonsense probably null
R7677:Fer1l6 UTSW 15 58,474,139 (GRCm39) missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58,502,486 (GRCm39) missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58,432,345 (GRCm39) missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58,414,012 (GRCm39) missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58,455,329 (GRCm39) missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58,502,594 (GRCm39) missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58,515,715 (GRCm39) missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58,494,230 (GRCm39) missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58,490,766 (GRCm39) missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58,429,759 (GRCm39) missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58,490,370 (GRCm39) missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58,422,113 (GRCm39) missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58,497,098 (GRCm39) missense probably benign
X0021:Fer1l6 UTSW 15 58,441,051 (GRCm39) nonsense probably null
X0027:Fer1l6 UTSW 15 58,501,189 (GRCm39) missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58,490,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGAACCACAGTCTCATGG -3'
(R):5'- TACAGGAGGTCTTCTGGAGC -3'

Sequencing Primer
(F):5'- CAGTCTCATGGATGACTACCAGG -3'
(R):5'- CTTCTGGAGCCTGTGACAAGTAC -3'
Posted On 2019-05-15