Incidental Mutation 'R7088:Exoc6'
ID 550053
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Name exocyst complex component 6
Synonyms msec15, 4833405E05Rik, hbd, Sec15l1, Sec15
MMRRC Submission 045182-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7088 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 37525181-37672499 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 37565458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 178 (C178F)
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000066439
AA Change: C178F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: C178F

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,331,232 (GRCm39) E48* probably null Het
Acaca T C 11: 84,169,783 (GRCm39) probably null Het
Albfm1 T A 5: 90,720,609 (GRCm39) L260* probably null Het
Alkbh3 A G 2: 93,835,097 (GRCm39) S83P possibly damaging Het
Ammecr1l T C 18: 31,904,872 (GRCm39) S38P probably benign Het
Armc10 T C 5: 21,858,390 (GRCm39) V145A probably damaging Het
BC048671 A G 6: 90,280,222 (GRCm39) K46R probably null Het
C2cd3 A G 7: 100,065,388 (GRCm39) T347A Het
C8b G T 4: 104,650,540 (GRCm39) E449D probably benign Het
Camk4 T C 18: 33,072,584 (GRCm39) S46P probably benign Het
Ccdc113 G A 8: 96,264,733 (GRCm39) R81H probably benign Het
Cd177 A T 7: 24,444,558 (GRCm39) C674* probably null Het
Cdc6 T A 11: 98,810,065 (GRCm39) V458D probably damaging Het
Cenpo C T 12: 4,265,307 (GRCm39) E238K probably benign Het
Ckap2 G T 8: 22,659,882 (GRCm39) P533Q possibly damaging Het
Cma1 T A 14: 56,181,273 (GRCm39) H44L probably damaging Het
Cmya5 A T 13: 93,228,372 (GRCm39) S2239T possibly damaging Het
Cntnap5b T A 1: 100,087,802 (GRCm39) I141N probably damaging Het
Col6a4 T A 9: 105,877,885 (GRCm39) T2031S possibly damaging Het
Cplane1 C T 15: 8,248,431 (GRCm39) T1660M probably benign Het
Cxcr5 T A 9: 44,424,683 (GRCm39) T325S possibly damaging Het
Dhx32 A T 7: 133,344,417 (GRCm39) L204Q probably damaging Het
Dse A G 10: 34,029,885 (GRCm39) Y402H probably damaging Het
Ecpas A T 4: 58,849,766 (GRCm39) L458I possibly damaging Het
Fam149a A G 8: 45,803,582 (GRCm39) V384A probably benign Het
Fcrl5 T C 3: 87,365,141 (GRCm39) *597Q probably null Het
Fer1l6 A G 15: 58,435,899 (GRCm39) K431E possibly damaging Het
Fmo3 T A 1: 162,796,434 (GRCm39) H46L probably benign Het
Gcm2 T C 13: 41,256,840 (GRCm39) D303G probably damaging Het
Gk2 T C 5: 97,603,534 (GRCm39) M435V probably damaging Het
Gli1 C A 10: 127,171,868 (GRCm39) M295I probably damaging Het
Gm11444 G T 11: 85,737,862 (GRCm39) H109Q Het
Gtpbp1 T A 15: 79,603,483 (GRCm39) D182E Het
Hnf4g A T 3: 3,713,185 (GRCm39) probably null Het
Hsf2 G A 10: 57,388,188 (GRCm39) R483H probably damaging Het
Kcnq4 C T 4: 120,561,596 (GRCm39) R491H probably damaging Het
Lama3 T C 18: 12,715,602 (GRCm39) V1686A possibly damaging Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Mboat1 T G 13: 30,379,772 (GRCm39) probably null Het
Mdh1 T C 11: 21,508,484 (GRCm39) Y286C probably damaging Het
Mga G T 2: 119,792,417 (GRCm39) K2607N probably damaging Het
Morf4l1 C A 9: 89,979,433 (GRCm39) V183F possibly damaging Het
Mroh4 G A 15: 74,497,993 (GRCm39) R196W probably benign Het
Muc16 C A 9: 18,503,976 (GRCm39) M6438I probably damaging Het
Myom3 A G 4: 135,530,589 (GRCm39) Y1167C probably damaging Het
Neurl3 T C 1: 36,308,302 (GRCm39) E170G possibly damaging Het
Nsd3 T C 8: 26,156,050 (GRCm39) I539T probably benign Het
Nup155 T C 15: 8,186,177 (GRCm39) F1313S probably benign Het
Nxn A T 11: 76,153,974 (GRCm39) V287E possibly damaging Het
Or4a80 G A 2: 89,582,443 (GRCm39) T243I probably benign Het
Or7a38 A C 10: 78,753,593 (GRCm39) L306F probably benign Het
Or8c13 C A 9: 38,091,748 (GRCm39) V124F probably damaging Het
Pax6 A G 2: 105,526,753 (GRCm39) N220D probably benign Het
Pcdha11 G A 18: 37,138,470 (GRCm39) R33H probably benign Het
Pdzd8 A G 19: 59,333,389 (GRCm39) F211L probably damaging Het
Pear1 C A 3: 87,661,945 (GRCm39) V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pidd1 A T 7: 141,020,400 (GRCm39) V539E probably damaging Het
Ptprg A T 14: 12,207,365 (GRCm38) I878F probably damaging Het
Rabepk T C 2: 34,675,711 (GRCm39) T140A probably benign Het
Ranbp2 G T 10: 58,299,728 (GRCm39) R454L probably damaging Het
Rnf123 C T 9: 107,935,735 (GRCm39) R943Q probably null Het
Sash1 G A 10: 8,605,481 (GRCm39) R970* probably null Het
Serpinb2 C A 1: 107,452,422 (GRCm39) F333L probably damaging Het
Shank3 T A 15: 89,387,728 (GRCm39) probably null Het
Slc9a2 A C 1: 40,765,539 (GRCm39) I310L probably damaging Het
Strip2 T A 6: 29,920,532 (GRCm39) probably null Het
Thoc3 T C 13: 54,611,565 (GRCm39) T241A probably damaging Het
Tmem139 T A 6: 42,240,199 (GRCm39) V2E probably damaging Het
Usp24 G T 4: 106,244,743 (GRCm39) V1233F probably damaging Het
Vnn1 A G 10: 23,776,645 (GRCm39) Q332R probably benign Het
Wac T A 18: 7,921,455 (GRCm39) H530Q probably damaging Het
Wdr35 T A 12: 9,028,659 (GRCm39) N92K probably benign Het
Zbtb18 T G 1: 177,274,820 (GRCm39) L60R probably damaging Het
Zfp184 T A 13: 22,144,162 (GRCm39) C623S probably damaging Het
Zfp292 A G 4: 34,806,796 (GRCm39) Y2088H probably damaging Het
Zfp975 G T 7: 42,312,096 (GRCm39) S172R probably benign Het
Zswim2 G A 2: 83,746,071 (GRCm39) Q456* probably null Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37,578,324 (GRCm39) missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37,671,412 (GRCm39) missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37,597,402 (GRCm39) missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37,566,922 (GRCm39) missense probably benign
IGL03394:Exoc6 APN 19 37,588,020 (GRCm39) missense probably benign 0.15
australamerican UTSW 19 37,587,127 (GRCm39) critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37,582,217 (GRCm39) critical splice donor site probably null
R1156:Exoc6 UTSW 19 37,671,345 (GRCm39) missense probably benign 0.05
R1489:Exoc6 UTSW 19 37,585,568 (GRCm39) missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37,628,217 (GRCm39) splice site probably null
R2125:Exoc6 UTSW 19 37,579,389 (GRCm39) missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37,641,861 (GRCm39) missense probably benign 0.34
R4090:Exoc6 UTSW 19 37,560,360 (GRCm39) missense probably benign
R4666:Exoc6 UTSW 19 37,558,953 (GRCm39) missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37,597,530 (GRCm39) missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37,587,127 (GRCm39) critical splice donor site probably null
R5471:Exoc6 UTSW 19 37,588,065 (GRCm39) missense probably benign 0.30
R5533:Exoc6 UTSW 19 37,582,218 (GRCm39) splice site probably null
R5607:Exoc6 UTSW 19 37,566,977 (GRCm39) missense probably benign 0.01
R5641:Exoc6 UTSW 19 37,576,081 (GRCm39) splice site probably null
R5759:Exoc6 UTSW 19 37,562,189 (GRCm39) nonsense probably null
R5889:Exoc6 UTSW 19 37,570,693 (GRCm39) missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37,560,360 (GRCm39) missense probably benign
R6936:Exoc6 UTSW 19 37,560,311 (GRCm39) missense probably benign 0.00
R6988:Exoc6 UTSW 19 37,597,539 (GRCm39) missense probably damaging 1.00
R7162:Exoc6 UTSW 19 37,565,566 (GRCm39) missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37,565,422 (GRCm39) missense probably benign 0.00
R8266:Exoc6 UTSW 19 37,565,497 (GRCm39) missense probably benign 0.00
R8525:Exoc6 UTSW 19 37,597,440 (GRCm39) missense possibly damaging 0.53
R8917:Exoc6 UTSW 19 37,578,360 (GRCm39) missense probably benign 0.35
R9003:Exoc6 UTSW 19 37,587,097 (GRCm39) missense probably damaging 1.00
R9159:Exoc6 UTSW 19 37,597,478 (GRCm39) missense probably benign 0.00
R9435:Exoc6 UTSW 19 37,585,545 (GRCm39) missense probably benign 0.00
R9459:Exoc6 UTSW 19 37,574,341 (GRCm39) missense probably benign 0.00
R9527:Exoc6 UTSW 19 37,558,987 (GRCm39) missense probably benign 0.26
R9563:Exoc6 UTSW 19 37,588,071 (GRCm39) missense probably damaging 1.00
R9730:Exoc6 UTSW 19 37,588,032 (GRCm39) missense probably benign 0.02
RF009:Exoc6 UTSW 19 37,560,068 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCATGCTAGGCACATGTCC -3'
(R):5'- TAAGGCTAACCGCAACTAAGCATG -3'

Sequencing Primer
(F):5'- ACATGTCCCTGCACTGAGAGTC -3'
(R):5'- TAAGCATGCCGGGACACACTG -3'
Posted On 2019-05-15