Mutagenetix > Incidental Mutation

Incidental Mutation 'R7088:Exoc6'

550053

Institutional Source

Beutler Lab

Gene Symbol

Exoc6

Ensembl Gene

ENSMUSG00000053799

Gene Name

exocyst complex component 6

Synonyms

msec15, Sec15l1, 4833405E05Rik, Sec15, hbd

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37550418-37683245 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37577010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 178 (C178F)

Ref Sequence

ENSEMBL: ENSMUSP00000064332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066439]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000066439
AA Change: C178F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: C178F

Domain	Start	End	E-Value	Type
low complexity region	265	273	N/A	INTRINSIC
Pfam:Sec15	456	762	8.1e-109	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
2410089E03Rik	C	T	15: 8,218,947	T1660M	probably benign	Het
5830473C10Rik	T	A	5: 90,572,750	L260*	probably null	Het
Acaca	T	C	11: 84,278,957		probably null	Het
AI314180	A	T	4: 58,849,766	L458I	possibly damaging	Het
Alkbh3	A	G	2: 94,004,752	S83P	possibly damaging	Het
Ammecr1l	T	C	18: 31,771,819	S38P	probably benign	Het
Armc10	T	C	5: 21,653,392	V145A	probably damaging	Het
BC048671	A	G	6: 90,303,240	K46R	probably null	Het
C2cd3	A	G	7: 100,416,181	T347A		Het
C8b	G	T	4: 104,793,343	E449D	probably benign	Het
Camk4	T	C	18: 32,939,531	S46P	probably benign	Het
Ccdc113	G	A	8: 95,538,105	R81H	probably benign	Het
Cd177	A	T	7: 24,745,133	C674*	probably null	Het
Cdc6	T	A	11: 98,919,239	V458D	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Ckap2	G	T	8: 22,169,866	P533Q	possibly damaging	Het
Cma1	T	A	14: 55,943,816	H44L	probably damaging	Het
Cmya5	A	T	13: 93,091,864	S2239T	possibly damaging	Het
Cntnap5b	T	A	1: 100,160,077	I141N	probably damaging	Het
Col6a4	T	A	9: 106,000,686	T2031S	possibly damaging	Het
Cxcr5	T	A	9: 44,513,386	T325S	possibly damaging	Het
Dhx32	A	T	7: 133,742,688	L204Q	probably damaging	Het
Dse	A	G	10: 34,153,889	Y402H	probably damaging	Het
Fam149a	A	G	8: 45,350,545	V384A	probably benign	Het
Fcrl5	T	C	3: 87,457,834	*597Q	probably null	Het
Fer1l6	A	G	15: 58,564,050	K431E	possibly damaging	Het
Fmo3	T	A	1: 162,968,865	H46L	probably benign	Het
Gcm2	T	C	13: 41,103,364	D303G	probably damaging	Het
Gk2	T	C	5: 97,455,675	M435V	probably damaging	Het
Gli1	C	A	10: 127,335,999	M295I	probably damaging	Het
Gm11444	G	T	11: 85,847,036	H109Q		Het
Gtpbp1	T	A	15: 79,719,282	D182E		Het
Hnf4g	A	T	3: 3,648,125		probably null	Het
Hsf2	G	A	10: 57,512,092	R483H	probably damaging	Het
Kcnq4	C	T	4: 120,704,399	R491H	probably damaging	Het
Lama3	T	C	18: 12,582,545	V1686A	possibly damaging	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Mboat1	T	G	13: 30,195,789		probably null	Het
Mdh1	T	C	11: 21,558,484	Y286C	probably damaging	Het
Mga	G	T	2: 119,961,936	K2607N	probably damaging	Het
Morf4l1	C	A	9: 90,097,380	V183F	possibly damaging	Het
Mroh4	G	A	15: 74,626,144	R196W	probably benign	Het
Muc16	C	A	9: 18,592,680	M6438I	probably damaging	Het
Myom3	A	G	4: 135,803,278	Y1167C	probably damaging	Het
Neurl3	T	C	1: 36,269,221	E170G	possibly damaging	Het
Nsd3	T	C	8: 25,666,034	I539T	probably benign	Het
Nup155	T	C	15: 8,156,693	F1313S	probably benign	Het
Nxn	A	T	11: 76,263,148	V287E	possibly damaging	Het
Olfr1253	G	A	2: 89,752,099	T243I	probably benign	Het
Olfr1354	A	C	10: 78,917,759	L306F	probably benign	Het
Olfr891	C	A	9: 38,180,452	V124F	probably damaging	Het
Pax6	A	G	2: 105,696,408	N220D	probably benign	Het
Pcdha11	G	A	18: 37,005,417	R33H	probably benign	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pear1	C	A	3: 87,754,638	V477F	possibly damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pidd1	A	T	7: 141,440,487	V539E	probably damaging	Het
Ptprg	A	T	14: 12,207,365	I878F	probably damaging	Het
Rabepk	T	C	2: 34,785,699	T140A	probably benign	Het
Ranbp2	G	T	10: 58,463,906	R454L	probably damaging	Het
Rnf123	C	T	9: 108,058,536	R943Q	probably null	Het
Sash1	G	A	10: 8,729,717	R970*	probably null	Het
Serpinb2	C	A	1: 107,524,692	F333L	probably damaging	Het
Shank3	T	A	15: 89,503,525		probably null	Het
Slc9a2	A	C	1: 40,726,379	I310L	probably damaging	Het
Strip2	T	A	6: 29,920,533		probably null	Het
Thoc3	T	C	13: 54,463,752	T241A	probably damaging	Het
Tmem139	T	A	6: 42,263,265	V2E	probably damaging	Het
Usp24	G	T	4: 106,387,546	V1233F	probably damaging	Het
Vnn1	A	G	10: 23,900,747	Q332R	probably benign	Het
Wac	T	A	18: 7,921,455	H530Q	probably damaging	Het
Wdr35	T	A	12: 8,978,659	N92K	probably benign	Het
Zbtb18	T	G	1: 177,447,254	L60R	probably damaging	Het
Zfp184	T	A	13: 21,959,992	C623S	probably damaging	Het
Zfp292	A	G	4: 34,806,796	Y2088H	probably damaging	Het
Zfp975	G	T	7: 42,662,672	S172R	probably benign	Het
Zswim2	G	A	2: 83,915,727	Q456*	probably null	Het

Other mutations in Exoc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Exoc6	APN	19	37589876	missense	possibly damaging	0.68
IGL01716:Exoc6	APN	19	37682964	missense	probably damaging	0.98
IGL02363:Exoc6	APN	19	37608954	missense	probably damaging	1.00
IGL02383:Exoc6	APN	19	37578474	missense	probably benign
IGL03394:Exoc6	APN	19	37599572	missense	probably benign	0.15
australamerican	UTSW	19	37598679	critical splice donor site	probably null
IGL03046:Exoc6	UTSW	19	37593769	critical splice donor site	probably null
R1156:Exoc6	UTSW	19	37682897	missense	probably benign	0.05
R1489:Exoc6	UTSW	19	37597120	missense	possibly damaging	0.71
R1747:Exoc6	UTSW	19	37639769	splice site	probably null
R2125:Exoc6	UTSW	19	37590941	missense	probably damaging	1.00
R2863:Exoc6	UTSW	19	37653413	missense	probably benign	0.34
R4090:Exoc6	UTSW	19	37571912	missense	probably benign
R4666:Exoc6	UTSW	19	37570505	missense	probably damaging	0.97
R4674:Exoc6	UTSW	19	37609082	missense	probably damaging	1.00
R5382:Exoc6	UTSW	19	37598679	critical splice donor site	probably null
R5471:Exoc6	UTSW	19	37599617	missense	probably benign	0.30
R5533:Exoc6	UTSW	19	37593770	splice site	probably null
R5607:Exoc6	UTSW	19	37578529	missense	probably benign	0.01
R5641:Exoc6	UTSW	19	37587633	splice site	probably null
R5759:Exoc6	UTSW	19	37573741	nonsense	probably null
R5889:Exoc6	UTSW	19	37582245	missense	probably damaging	1.00
R6592:Exoc6	UTSW	19	37571912	missense	probably benign
R6936:Exoc6	UTSW	19	37571863	missense	probably benign	0.00
R6988:Exoc6	UTSW	19	37609091	missense	probably damaging	1.00
R7162:Exoc6	UTSW	19	37577118	missense	probably damaging	0.97
R7948:Exoc6	UTSW	19	37576974	missense	probably benign	0.00
R8266:Exoc6	UTSW	19	37577049	missense	probably benign	0.00
R8525:Exoc6	UTSW	19	37608992	missense	possibly damaging	0.53
R8917:Exoc6	UTSW	19	37589912	missense	probably benign	0.35
R9003:Exoc6	UTSW	19	37598649	missense	probably damaging	1.00
R9159:Exoc6	UTSW	19	37609030	missense	probably benign	0.00
R9435:Exoc6	UTSW	19	37597097	missense	probably benign	0.00
R9459:Exoc6	UTSW	19	37585893	missense	probably benign	0.00
R9527:Exoc6	UTSW	19	37570539	missense	probably benign	0.26
R9563:Exoc6	UTSW	19	37599623	missense	probably damaging	1.00
R9730:Exoc6	UTSW	19	37599584	missense	probably benign	0.02
RF009:Exoc6	UTSW	19	37571620	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCATGCTAGGCACATGTCC -3'
(R):5'- TAAGGCTAACCGCAACTAAGCATG -3'

Sequencing Primer
(F):5'- ACATGTCCCTGCACTGAGAGTC -3'
(R):5'- TAAGCATGCCGGGACACACTG -3'

Posted On

2019-05-15