Incidental Mutation 'R7089:Otof'
ID550068
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7089 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30371568 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1827 (I1827S)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074171
AA Change: I1832S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: I1832S

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101448
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114747
AA Change: I1827S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: I1827S

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.4522 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik A T 15: 82,252,573 probably benign Het
1700010I14Rik T C 17: 9,008,095 V494A probably benign Het
1700011I03Rik C T 18: 57,591,987 T96I probably benign Het
1700017B05Rik A T 9: 57,258,758 L111Q probably damaging Het
Adgrf4 T G 17: 42,666,533 I640L possibly damaging Het
Afdn T G 17: 13,890,812 probably null Het
Ammecr1l A T 18: 31,761,824 probably benign Het
Aox2 A T 1: 58,336,649 Y879F probably benign Het
Arhgap45 G A 10: 80,026,347 probably null Het
Arpp21 G T 9: 112,126,446 H542N probably benign Het
Cdt1 G A 8: 122,571,980 R452Q probably damaging Het
Clcn7 C T 17: 25,153,693 H149Y Het
Clpp T G 17: 56,990,421 W32G probably benign Het
Dnmt1 G T 9: 20,908,489 L1572M probably damaging Het
Drd3 G T 16: 43,807,378 R128S probably damaging Het
Elmo2 A T 2: 165,304,929 F243I possibly damaging Het
Endou G A 15: 97,720,245 P128L probably benign Het
Fat3 A G 9: 15,996,918 M2596T probably benign Het
Fbxl16 A G 17: 25,816,729 K100R probably benign Het
Fbxo10 A G 4: 45,062,230 S99P possibly damaging Het
Fez1 A T 9: 36,867,703 R225S probably benign Het
Gm14326 A T 2: 177,946,671 H177Q probably damaging Het
Gm32742 T A 9: 51,143,246 M1360L probably benign Het
Hspg2 T C 4: 137,544,366 V2481A possibly damaging Het
Ifnl3 A G 7: 28,523,858 K101E probably benign Het
Il15 A T 8: 82,337,575 S77R probably damaging Het
Ints13 T C 6: 146,574,718 D95G probably damaging Het
Kcmf1 G A 6: 72,842,946 P357S probably benign Het
Kcmf1 G T 6: 72,848,306 T268K probably benign Het
Kmt2d A T 15: 98,850,272 I3057N unknown Het
Lgi2 A G 5: 52,538,490 F376L probably damaging Het
Lrig3 T G 10: 125,997,124 L289R probably damaging Het
Mafk A G 5: 139,800,121 S25G probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Nalcn A C 14: 123,278,349 I1680R probably benign Het
Olfr154 C T 2: 85,664,174 V87M possibly damaging Het
Olfr270 C T 4: 52,971,470 P283L probably damaging Het
Olfr486 A T 7: 108,172,494 N83K probably benign Het
Olfr994 T A 2: 85,430,558 K90N probably benign Het
Oxgr1 A G 14: 120,022,202 Y198H probably damaging Het
P3h2 T A 16: 25,965,809 N645I probably damaging Het
Pbld2 A G 10: 63,053,912 T158A probably benign Het
Pdgfrb C T 18: 61,073,243 R608C probably damaging Het
Pdia5 T C 16: 35,407,679 T408A probably benign Het
Pik3cg A G 12: 32,176,846 V1014A probably benign Het
Prpf8 A G 11: 75,508,548 T2180A probably damaging Het
Rabgap1l A T 1: 160,724,172 Y245* probably null Het
Rerg T C 6: 137,067,035 T28A possibly damaging Het
Rhcg A G 7: 79,599,468 I335T probably damaging Het
Rmnd1 C T 10: 4,403,873 V78I probably damaging Het
Ryr2 A C 13: 11,649,776 V3547G probably benign Het
Scnn1a C A 6: 125,337,807 Q324K probably benign Het
Serpinb6e G A 13: 33,832,715 T345I probably damaging Het
Smchd1 T C 17: 71,361,960 T1687A probably benign Het
Speer4f2 A C 5: 17,376,663 H201P Het
Spef2 G A 15: 9,725,171 R167C probably damaging Het
Srp68 A G 11: 116,271,907 probably null Het
Tbc1d14 A T 5: 36,512,540 F455I probably benign Het
Tet3 A G 6: 83,455,024 V10A possibly damaging Het
Tlr3 A T 8: 45,397,773 S696T probably benign Het
Tmem63b T C 17: 45,667,783 N300S probably benign Het
Tmprss11g T C 5: 86,489,291 I328M probably damaging Het
Tpm3 C T 3: 90,072,722 probably benign Het
Trim28 T A 7: 13,024,906 L63Q probably damaging Het
Unc5b G A 10: 60,777,486 R324C probably damaging Het
Vmn1r236 T A 17: 21,286,942 N107K possibly damaging Het
Vmn2r88 A G 14: 51,418,643 T770A Het
Zcchc2 C A 1: 106,030,481 P894Q probably damaging Het
Zfhx2 A G 14: 55,065,772 V1585A probably benign Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
R7393:Otof UTSW 5 30370270 missense probably benign 0.45
R7397:Otof UTSW 5 30375707 missense probably damaging 1.00
R7400:Otof UTSW 5 30385188 missense probably benign 0.04
R7428:Otof UTSW 5 30389825 missense probably damaging 1.00
R7456:Otof UTSW 5 30394661 missense probably damaging 1.00
R7505:Otof UTSW 5 30371020 missense probably benign 0.00
R7714:Otof UTSW 5 30370253 missense probably damaging 0.99
R8002:Otof UTSW 5 30380610 missense probably benign 0.10
R8032:Otof UTSW 5 30461798 start codon destroyed probably benign 0.07
R8153:Otof UTSW 5 30388735 missense probably damaging 1.00
R8158:Otof UTSW 5 30380194 missense probably benign 0.37
R8159:Otof UTSW 5 30380194 missense probably benign 0.37
R8441:Otof UTSW 5 30380856 missense probably damaging 0.99
Z1176:Otof UTSW 5 30371586 missense probably damaging 0.98
Z1177:Otof UTSW 5 30376297 missense probably damaging 1.00
Z1177:Otof UTSW 5 30383658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAAGATTCTTGGAGAGGC -3'
(R):5'- TTTCTGGGAGAAGGGGATCC -3'

Sequencing Primer
(F):5'- GAGGCAAGATTCCCATTTGC -3'
(R):5'- AGCTGGAGCAGGTGACTC -3'
Posted On2019-05-15