Mutagenetix > Incidental Mutation

Incidental Mutation 'R7089:Lrig3'

550096

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

045183-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R7089 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 125997124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 289 (L289R)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074807
AA Change: L289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: L289R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009C09Rik	A	T	15: 82,252,573		probably benign	Het
1700010I14Rik	T	C	17: 9,008,095	V494A	probably benign	Het
1700011I03Rik	C	T	18: 57,591,987	T96I	probably benign	Het
1700017B05Rik	A	T	9: 57,258,758	L111Q	probably damaging	Het
Adgrf4	T	G	17: 42,666,533	I640L	possibly damaging	Het
Afdn	T	G	17: 13,890,812		probably null	Het
Ammecr1l	A	T	18: 31,761,824		probably benign	Het
Aox2	A	T	1: 58,336,649	Y879F	probably benign	Het
Arhgap45	G	A	10: 80,026,347		probably null	Het
Arpp21	G	T	9: 112,126,446	H542N	probably benign	Het
Cdt1	G	A	8: 122,571,980	R452Q	probably damaging	Het
Clcn7	C	T	17: 25,153,693	H149Y		Het
Clpp	T	G	17: 56,990,421	W32G	probably benign	Het
Dnmt1	G	T	9: 20,908,489	L1572M	probably damaging	Het
Drd3	G	T	16: 43,807,378	R128S	probably damaging	Het
Elmo2	A	T	2: 165,304,929	F243I	possibly damaging	Het
Endou	G	A	15: 97,720,245	P128L	probably benign	Het
Fat3	A	G	9: 15,996,918	M2596T	probably benign	Het
Fbxl16	A	G	17: 25,816,729	K100R	probably benign	Het
Fbxo10	A	G	4: 45,062,230	S99P	possibly damaging	Het
Fez1	A	T	9: 36,867,703	R225S	probably benign	Het
Gm14326	A	T	2: 177,946,671	H177Q	probably damaging	Het
Gm32742	T	A	9: 51,143,246	M1360L	probably benign	Het
Hspg2	T	C	4: 137,544,366	V2481A	possibly damaging	Het
Ifnl3	A	G	7: 28,523,858	K101E	probably benign	Het
Il15	A	T	8: 82,337,575	S77R	probably damaging	Het
Ints13	T	C	6: 146,574,718	D95G	probably damaging	Het
Kcmf1	G	A	6: 72,842,946	P357S	probably benign	Het
Kcmf1	G	T	6: 72,848,306	T268K	probably benign	Het
Kmt2d	A	T	15: 98,850,272	I3057N	unknown	Het
Lgi2	A	G	5: 52,538,490	F376L	probably damaging	Het
Mafk	A	G	5: 139,800,121	S25G	probably benign	Het
Mpz	T	C	1: 171,159,635		probably null	Het
Nalcn	A	C	14: 123,278,349	I1680R	probably benign	Het
Olfr154	C	T	2: 85,664,174	V87M	possibly damaging	Het
Olfr270	C	T	4: 52,971,470	P283L	probably damaging	Het
Olfr486	A	T	7: 108,172,494	N83K	probably benign	Het
Olfr994	T	A	2: 85,430,558	K90N	probably benign	Het
Otof	A	C	5: 30,371,568	I1827S	possibly damaging	Het
Oxgr1	A	G	14: 120,022,202	Y198H	probably damaging	Het
P3h2	T	A	16: 25,965,809	N645I	probably damaging	Het
Pbld2	A	G	10: 63,053,912	T158A	probably benign	Het
Pdgfrb	C	T	18: 61,073,243	R608C	probably damaging	Het
Pdia5	T	C	16: 35,407,679	T408A	probably benign	Het
Pik3cg	A	G	12: 32,176,846	V1014A	probably benign	Het
Prpf8	A	G	11: 75,508,548	T2180A	probably damaging	Het
Rabgap1l	A	T	1: 160,724,172	Y245*	probably null	Het
Rerg	T	C	6: 137,067,035	T28A	possibly damaging	Het
Rhcg	A	G	7: 79,599,468	I335T	probably damaging	Het
Rmnd1	C	T	10: 4,403,873	V78I	probably damaging	Het
Ryr2	A	C	13: 11,649,776	V3547G	probably benign	Het
Scnn1a	C	A	6: 125,337,807	Q324K	probably benign	Het
Serpinb6e	G	A	13: 33,832,715	T345I	probably damaging	Het
Smchd1	T	C	17: 71,361,960	T1687A	probably benign	Het
Speer4f2	A	C	5: 17,376,663	H201P		Het
Spef2	G	A	15: 9,725,171	R167C	probably damaging	Het
Srp68	A	G	11: 116,271,907		probably null	Het
Tbc1d14	A	T	5: 36,512,540	F455I	probably benign	Het
Tet3	A	G	6: 83,455,024	V10A	possibly damaging	Het
Tlr3	A	T	8: 45,397,773	S696T	probably benign	Het
Tmem63b	T	C	17: 45,667,783	N300S	probably benign	Het
Tmprss11g	T	C	5: 86,489,291	I328M	probably damaging	Het
Tpm3	C	T	3: 90,072,722		probably benign	Het
Trim28	T	A	7: 13,024,906	L63Q	probably damaging	Het
Unc5b	G	A	10: 60,777,486	R324C	probably damaging	Het
Vmn1r236	T	A	17: 21,286,942	N107K	possibly damaging	Het
Vmn2r88	A	G	14: 51,418,643	T770A		Het
Zcchc2	C	A	1: 106,030,481	P894Q	probably damaging	Het
Zfhx2	A	G	14: 55,065,772	V1585A	probably benign	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1398:Lrig3	UTSW	10	126003088	missense	probably benign	0.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTGATCTCCTTATATATCAAAGCCG -3'
(R):5'- CACACAGAAAAGCGGCTGTC -3'

Sequencing Primer
(F):5'- GACTATCTAGGCGTGTTAGGGATATG -3'
(R):5'- GTCGCCTTGGCAACTTTG -3'

Posted On

2019-05-15