Incidental Mutation 'R7089:Lrig3'
ID550096
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R7089 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125997124 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 289 (L289R)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074807
AA Change: L289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: L289R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik A T 15: 82,252,573 probably benign Het
1700010I14Rik T C 17: 9,008,095 V494A probably benign Het
1700011I03Rik C T 18: 57,591,987 T96I probably benign Het
1700017B05Rik A T 9: 57,258,758 L111Q probably damaging Het
Adgrf4 T G 17: 42,666,533 I640L possibly damaging Het
Afdn T G 17: 13,890,812 probably null Het
Ammecr1l A T 18: 31,761,824 probably benign Het
Aox2 A T 1: 58,336,649 Y879F probably benign Het
Arhgap45 G A 10: 80,026,347 probably null Het
Arpp21 G T 9: 112,126,446 H542N probably benign Het
Cdt1 G A 8: 122,571,980 R452Q probably damaging Het
Clcn7 C T 17: 25,153,693 H149Y Het
Clpp T G 17: 56,990,421 W32G probably benign Het
Dnmt1 G T 9: 20,908,489 L1572M probably damaging Het
Drd3 G T 16: 43,807,378 R128S probably damaging Het
Elmo2 A T 2: 165,304,929 F243I possibly damaging Het
Endou G A 15: 97,720,245 P128L probably benign Het
Fat3 A G 9: 15,996,918 M2596T probably benign Het
Fbxl16 A G 17: 25,816,729 K100R probably benign Het
Fbxo10 A G 4: 45,062,230 S99P possibly damaging Het
Fez1 A T 9: 36,867,703 R225S probably benign Het
Gm14326 A T 2: 177,946,671 H177Q probably damaging Het
Gm32742 T A 9: 51,143,246 M1360L probably benign Het
Hspg2 T C 4: 137,544,366 V2481A possibly damaging Het
Ifnl3 A G 7: 28,523,858 K101E probably benign Het
Il15 A T 8: 82,337,575 S77R probably damaging Het
Ints13 T C 6: 146,574,718 D95G probably damaging Het
Kcmf1 G A 6: 72,842,946 P357S probably benign Het
Kcmf1 G T 6: 72,848,306 T268K probably benign Het
Kmt2d A T 15: 98,850,272 I3057N unknown Het
Lgi2 A G 5: 52,538,490 F376L probably damaging Het
Mafk A G 5: 139,800,121 S25G probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Nalcn A C 14: 123,278,349 I1680R probably benign Het
Olfr154 C T 2: 85,664,174 V87M possibly damaging Het
Olfr270 C T 4: 52,971,470 P283L probably damaging Het
Olfr486 A T 7: 108,172,494 N83K probably benign Het
Olfr994 T A 2: 85,430,558 K90N probably benign Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Oxgr1 A G 14: 120,022,202 Y198H probably damaging Het
P3h2 T A 16: 25,965,809 N645I probably damaging Het
Pbld2 A G 10: 63,053,912 T158A probably benign Het
Pdgfrb C T 18: 61,073,243 R608C probably damaging Het
Pdia5 T C 16: 35,407,679 T408A probably benign Het
Pik3cg A G 12: 32,176,846 V1014A probably benign Het
Prpf8 A G 11: 75,508,548 T2180A probably damaging Het
Rabgap1l A T 1: 160,724,172 Y245* probably null Het
Rerg T C 6: 137,067,035 T28A possibly damaging Het
Rhcg A G 7: 79,599,468 I335T probably damaging Het
Rmnd1 C T 10: 4,403,873 V78I probably damaging Het
Ryr2 A C 13: 11,649,776 V3547G probably benign Het
Scnn1a C A 6: 125,337,807 Q324K probably benign Het
Serpinb6e G A 13: 33,832,715 T345I probably damaging Het
Smchd1 T C 17: 71,361,960 T1687A probably benign Het
Speer4f2 A C 5: 17,376,663 H201P Het
Spef2 G A 15: 9,725,171 R167C probably damaging Het
Srp68 A G 11: 116,271,907 probably null Het
Tbc1d14 A T 5: 36,512,540 F455I probably benign Het
Tet3 A G 6: 83,455,024 V10A possibly damaging Het
Tlr3 A T 8: 45,397,773 S696T probably benign Het
Tmem63b T C 17: 45,667,783 N300S probably benign Het
Tmprss11g T C 5: 86,489,291 I328M probably damaging Het
Tpm3 C T 3: 90,072,722 probably benign Het
Trim28 T A 7: 13,024,906 L63Q probably damaging Het
Unc5b G A 10: 60,777,486 R324C probably damaging Het
Vmn1r236 T A 17: 21,286,942 N107K possibly damaging Het
Vmn2r88 A G 14: 51,418,643 T770A Het
Zcchc2 C A 1: 106,030,481 P894Q probably damaging Het
Zfhx2 A G 14: 55,065,772 V1585A probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1398:Lrig3 UTSW 10 126003088 missense probably benign 0.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATCTCCTTATATATCAAAGCCG -3'
(R):5'- CACACAGAAAAGCGGCTGTC -3'

Sequencing Primer
(F):5'- GACTATCTAGGCGTGTTAGGGATATG -3'
(R):5'- GTCGCCTTGGCAACTTTG -3'
Posted On2019-05-15