Mutagenetix > Incidental Mutation

Incidental Mutation 'R7089:Prpf8'

550097

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R7089 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75508548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2180 (T2180A)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000102510] [ENSMUST00000118243]

AlphaFold

Q99PV0

Predicted Effect

probably damaging
Transcript: ENSMUST00000018449
AA Change: T2180A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: T2180A

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000042808

SMART Domains

Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF	54	90	2.16e1	SMART
EGF	101	133	1.36e1	SMART
EGF_like	165	193	4.55e1	SMART
EGF_Lam	225	263	8.78e-2	SMART
EGF_like	262	296	4.93e1	SMART
EGF	307	341	2.69e1	SMART
EGF	352	384	2.25e1	SMART
transmembrane domain	424	446	N/A	INTRINSIC
low complexity region	520	535	N/A	INTRINSIC
low complexity region	791	805	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042972

SMART Domains

Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

Domain	Start	End	E-Value	Type
low complexity region	14	24	N/A	INTRINSIC
Pfam:Jnk-SapK_ap_N	27	195	2.1e-16	PFAM
Pfam:RILP	223	281	1.1e-21	PFAM
low complexity region	289	298	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102510
AA Change: T2180A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: T2180A

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118243

SMART Domains

Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF	54	90	2.16e1	SMART
EGF	101	133	1.36e1	SMART
EGF_like	165	193	4.55e1	SMART
EGF_Lam	225	263	8.78e-2	SMART
EGF_like	262	296	4.93e1	SMART
EGF	307	341	2.69e1	SMART
EGF	352	384	2.25e1	SMART
transmembrane domain	424	446	N/A	INTRINSIC

Meta Mutation Damage Score

0.7706

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009C09Rik	A	T	15: 82,252,573		probably benign	Het
1700010I14Rik	T	C	17: 9,008,095	V494A	probably benign	Het
1700011I03Rik	C	T	18: 57,591,987	T96I	probably benign	Het
1700017B05Rik	A	T	9: 57,258,758	L111Q	probably damaging	Het
Adgrf4	T	G	17: 42,666,533	I640L	possibly damaging	Het
Afdn	T	G	17: 13,890,812		probably null	Het
Ammecr1l	A	T	18: 31,761,824		probably benign	Het
Aox2	A	T	1: 58,336,649	Y879F	probably benign	Het
Arhgap45	G	A	10: 80,026,347		probably null	Het
Arpp21	G	T	9: 112,126,446	H542N	probably benign	Het
Cdt1	G	A	8: 122,571,980	R452Q	probably damaging	Het
Clcn7	C	T	17: 25,153,693	H149Y		Het
Clpp	T	G	17: 56,990,421	W32G	probably benign	Het
Dnmt1	G	T	9: 20,908,489	L1572M	probably damaging	Het
Drd3	G	T	16: 43,807,378	R128S	probably damaging	Het
Elmo2	A	T	2: 165,304,929	F243I	possibly damaging	Het
Endou	G	A	15: 97,720,245	P128L	probably benign	Het
Fat3	A	G	9: 15,996,918	M2596T	probably benign	Het
Fbxl16	A	G	17: 25,816,729	K100R	probably benign	Het
Fbxo10	A	G	4: 45,062,230	S99P	possibly damaging	Het
Fez1	A	T	9: 36,867,703	R225S	probably benign	Het
Gm14326	A	T	2: 177,946,671	H177Q	probably damaging	Het
Gm32742	T	A	9: 51,143,246	M1360L	probably benign	Het
Hspg2	T	C	4: 137,544,366	V2481A	possibly damaging	Het
Ifnl3	A	G	7: 28,523,858	K101E	probably benign	Het
Il15	A	T	8: 82,337,575	S77R	probably damaging	Het
Ints13	T	C	6: 146,574,718	D95G	probably damaging	Het
Kcmf1	G	A	6: 72,842,946	P357S	probably benign	Het
Kcmf1	G	T	6: 72,848,306	T268K	probably benign	Het
Kmt2d	A	T	15: 98,850,272	I3057N	unknown	Het
Lgi2	A	G	5: 52,538,490	F376L	probably damaging	Het
Lrig3	T	G	10: 125,997,124	L289R	probably damaging	Het
Mafk	A	G	5: 139,800,121	S25G	probably benign	Het
Mpz	T	C	1: 171,159,635		probably null	Het
Nalcn	A	C	14: 123,278,349	I1680R	probably benign	Het
Olfr154	C	T	2: 85,664,174	V87M	possibly damaging	Het
Olfr270	C	T	4: 52,971,470	P283L	probably damaging	Het
Olfr486	A	T	7: 108,172,494	N83K	probably benign	Het
Olfr994	T	A	2: 85,430,558	K90N	probably benign	Het
Otof	A	C	5: 30,371,568	I1827S	possibly damaging	Het
Oxgr1	A	G	14: 120,022,202	Y198H	probably damaging	Het
P3h2	T	A	16: 25,965,809	N645I	probably damaging	Het
Pbld2	A	G	10: 63,053,912	T158A	probably benign	Het
Pdgfrb	C	T	18: 61,073,243	R608C	probably damaging	Het
Pdia5	T	C	16: 35,407,679	T408A	probably benign	Het
Pik3cg	A	G	12: 32,176,846	V1014A	probably benign	Het
Rabgap1l	A	T	1: 160,724,172	Y245*	probably null	Het
Rerg	T	C	6: 137,067,035	T28A	possibly damaging	Het
Rhcg	A	G	7: 79,599,468	I335T	probably damaging	Het
Rmnd1	C	T	10: 4,403,873	V78I	probably damaging	Het
Ryr2	A	C	13: 11,649,776	V3547G	probably benign	Het
Scnn1a	C	A	6: 125,337,807	Q324K	probably benign	Het
Serpinb6e	G	A	13: 33,832,715	T345I	probably damaging	Het
Smchd1	T	C	17: 71,361,960	T1687A	probably benign	Het
Speer4f2	A	C	5: 17,376,663	H201P		Het
Spef2	G	A	15: 9,725,171	R167C	probably damaging	Het
Srp68	A	G	11: 116,271,907		probably null	Het
Tbc1d14	A	T	5: 36,512,540	F455I	probably benign	Het
Tet3	A	G	6: 83,455,024	V10A	possibly damaging	Het
Tlr3	A	T	8: 45,397,773	S696T	probably benign	Het
Tmem63b	T	C	17: 45,667,783	N300S	probably benign	Het
Tmprss11g	T	C	5: 86,489,291	I328M	probably damaging	Het
Tpm3	C	T	3: 90,072,722		probably benign	Het
Trim28	T	A	7: 13,024,906	L63Q	probably damaging	Het
Unc5b	G	A	10: 60,777,486	R324C	probably damaging	Het
Vmn1r236	T	A	17: 21,286,942	N107K	possibly damaging	Het
Vmn2r88	A	G	14: 51,418,643	T770A		Het
Zcchc2	C	A	1: 106,030,481	P894Q	probably damaging	Het
Zfhx2	A	G	14: 55,065,772	V1585A	probably benign	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TCAGGTGAAGGAGATCCGTTG -3'
(R):5'- AGACAGGAGCATCTGAACCC -3'

Sequencing Primer
(F):5'- ACCAGACTGTGCACCTGC -3'
(R):5'- GAGCATCTGAACCCTCTCGTAGTG -3'

Posted On

2019-05-15