Incidental Mutation 'R7089:Oxgr1'
ID550103
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Nameoxoglutarate (alpha-ketoglutarate) receptor 1
SynonymsLOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7089 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location120019585-120042435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120022202 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 198 (Y198H)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
Predicted Effect probably damaging
Transcript: ENSMUST00000058213
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: Y198H

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik A T 15: 82,252,573 probably benign Het
1700010I14Rik T C 17: 9,008,095 V494A probably benign Het
1700011I03Rik C T 18: 57,591,987 T96I probably benign Het
1700017B05Rik A T 9: 57,258,758 L111Q probably damaging Het
Adgrf4 T G 17: 42,666,533 I640L possibly damaging Het
Afdn T G 17: 13,890,812 probably null Het
Ammecr1l A T 18: 31,761,824 probably benign Het
Aox2 A T 1: 58,336,649 Y879F probably benign Het
Arhgap45 G A 10: 80,026,347 probably null Het
Arpp21 G T 9: 112,126,446 H542N probably benign Het
Cdt1 G A 8: 122,571,980 R452Q probably damaging Het
Clcn7 C T 17: 25,153,693 H149Y Het
Clpp T G 17: 56,990,421 W32G probably benign Het
Dnmt1 G T 9: 20,908,489 L1572M probably damaging Het
Drd3 G T 16: 43,807,378 R128S probably damaging Het
Elmo2 A T 2: 165,304,929 F243I possibly damaging Het
Endou G A 15: 97,720,245 P128L probably benign Het
Fat3 A G 9: 15,996,918 M2596T probably benign Het
Fbxl16 A G 17: 25,816,729 K100R probably benign Het
Fbxo10 A G 4: 45,062,230 S99P possibly damaging Het
Fez1 A T 9: 36,867,703 R225S probably benign Het
Gm14326 A T 2: 177,946,671 H177Q probably damaging Het
Gm32742 T A 9: 51,143,246 M1360L probably benign Het
Hspg2 T C 4: 137,544,366 V2481A possibly damaging Het
Ifnl3 A G 7: 28,523,858 K101E probably benign Het
Il15 A T 8: 82,337,575 S77R probably damaging Het
Ints13 T C 6: 146,574,718 D95G probably damaging Het
Kcmf1 G A 6: 72,842,946 P357S probably benign Het
Kcmf1 G T 6: 72,848,306 T268K probably benign Het
Kmt2d A T 15: 98,850,272 I3057N unknown Het
Lgi2 A G 5: 52,538,490 F376L probably damaging Het
Lrig3 T G 10: 125,997,124 L289R probably damaging Het
Mafk A G 5: 139,800,121 S25G probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Nalcn A C 14: 123,278,349 I1680R probably benign Het
Olfr154 C T 2: 85,664,174 V87M possibly damaging Het
Olfr270 C T 4: 52,971,470 P283L probably damaging Het
Olfr486 A T 7: 108,172,494 N83K probably benign Het
Olfr994 T A 2: 85,430,558 K90N probably benign Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
P3h2 T A 16: 25,965,809 N645I probably damaging Het
Pbld2 A G 10: 63,053,912 T158A probably benign Het
Pdgfrb C T 18: 61,073,243 R608C probably damaging Het
Pdia5 T C 16: 35,407,679 T408A probably benign Het
Pik3cg A G 12: 32,176,846 V1014A probably benign Het
Prpf8 A G 11: 75,508,548 T2180A probably damaging Het
Rabgap1l A T 1: 160,724,172 Y245* probably null Het
Rerg T C 6: 137,067,035 T28A possibly damaging Het
Rhcg A G 7: 79,599,468 I335T probably damaging Het
Rmnd1 C T 10: 4,403,873 V78I probably damaging Het
Ryr2 A C 13: 11,649,776 V3547G probably benign Het
Scnn1a C A 6: 125,337,807 Q324K probably benign Het
Serpinb6e G A 13: 33,832,715 T345I probably damaging Het
Smchd1 T C 17: 71,361,960 T1687A probably benign Het
Speer4f2 A C 5: 17,376,663 H201P Het
Spef2 G A 15: 9,725,171 R167C probably damaging Het
Srp68 A G 11: 116,271,907 probably null Het
Tbc1d14 A T 5: 36,512,540 F455I probably benign Het
Tet3 A G 6: 83,455,024 V10A possibly damaging Het
Tlr3 A T 8: 45,397,773 S696T probably benign Het
Tmem63b T C 17: 45,667,783 N300S probably benign Het
Tmprss11g T C 5: 86,489,291 I328M probably damaging Het
Tpm3 C T 3: 90,072,722 probably benign Het
Trim28 T A 7: 13,024,906 L63Q probably damaging Het
Unc5b G A 10: 60,777,486 R324C probably damaging Het
Vmn1r236 T A 17: 21,286,942 N107K possibly damaging Het
Vmn2r88 A G 14: 51,418,643 T770A Het
Zcchc2 C A 1: 106,030,481 P894Q probably damaging Het
Zfhx2 A G 14: 55,065,772 V1585A probably benign Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5213:Oxgr1 UTSW 14 120022140 nonsense probably null
R5226:Oxgr1 UTSW 14 120022253 missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120022257 missense probably damaging 1.00
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7819:Oxgr1 UTSW 14 120022869 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCAGGCGAGATTCGATC -3'
(R):5'- TCATTCACCCGATGAGCTGC -3'

Sequencing Primer
(F):5'- TCCGAATGACCCTCAAGATGTGG -3'
(R):5'- CGATGAGCTGCTTTTCTATTCAG -3'
Posted On2019-05-15