Incidental Mutation 'R7089:P3h2'
ID 550109
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Name prolyl 3-hydroxylase 2
Synonyms Leprel1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7089 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 25959288-26105784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25965809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 645 (N645I)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
AlphaFold Q8CG71
Predicted Effect probably damaging
Transcript: ENSMUST00000039990
AA Change: N645I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: N645I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Meta Mutation Damage Score 0.5355 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik A T 15: 82,252,573 probably benign Het
1700010I14Rik T C 17: 9,008,095 V494A probably benign Het
1700011I03Rik C T 18: 57,591,987 T96I probably benign Het
1700017B05Rik A T 9: 57,258,758 L111Q probably damaging Het
Adgrf4 T G 17: 42,666,533 I640L possibly damaging Het
Afdn T G 17: 13,890,812 probably null Het
Ammecr1l A T 18: 31,761,824 probably benign Het
Aox2 A T 1: 58,336,649 Y879F probably benign Het
Arhgap45 G A 10: 80,026,347 probably null Het
Arpp21 G T 9: 112,126,446 H542N probably benign Het
Cdt1 G A 8: 122,571,980 R452Q probably damaging Het
Clcn7 C T 17: 25,153,693 H149Y Het
Clpp T G 17: 56,990,421 W32G probably benign Het
Dnmt1 G T 9: 20,908,489 L1572M probably damaging Het
Drd3 G T 16: 43,807,378 R128S probably damaging Het
Elmo2 A T 2: 165,304,929 F243I possibly damaging Het
Endou G A 15: 97,720,245 P128L probably benign Het
Fat3 A G 9: 15,996,918 M2596T probably benign Het
Fbxl16 A G 17: 25,816,729 K100R probably benign Het
Fbxo10 A G 4: 45,062,230 S99P possibly damaging Het
Fez1 A T 9: 36,867,703 R225S probably benign Het
Gm14326 A T 2: 177,946,671 H177Q probably damaging Het
Gm32742 T A 9: 51,143,246 M1360L probably benign Het
Hspg2 T C 4: 137,544,366 V2481A possibly damaging Het
Ifnl3 A G 7: 28,523,858 K101E probably benign Het
Il15 A T 8: 82,337,575 S77R probably damaging Het
Ints13 T C 6: 146,574,718 D95G probably damaging Het
Kcmf1 G A 6: 72,842,946 P357S probably benign Het
Kcmf1 G T 6: 72,848,306 T268K probably benign Het
Kmt2d A T 15: 98,850,272 I3057N unknown Het
Lgi2 A G 5: 52,538,490 F376L probably damaging Het
Lrig3 T G 10: 125,997,124 L289R probably damaging Het
Mafk A G 5: 139,800,121 S25G probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Nalcn A C 14: 123,278,349 I1680R probably benign Het
Olfr154 C T 2: 85,664,174 V87M possibly damaging Het
Olfr270 C T 4: 52,971,470 P283L probably damaging Het
Olfr486 A T 7: 108,172,494 N83K probably benign Het
Olfr994 T A 2: 85,430,558 K90N probably benign Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Oxgr1 A G 14: 120,022,202 Y198H probably damaging Het
Pbld2 A G 10: 63,053,912 T158A probably benign Het
Pdgfrb C T 18: 61,073,243 R608C probably damaging Het
Pdia5 T C 16: 35,407,679 T408A probably benign Het
Pik3cg A G 12: 32,176,846 V1014A probably benign Het
Prpf8 A G 11: 75,508,548 T2180A probably damaging Het
Rabgap1l A T 1: 160,724,172 Y245* probably null Het
Rerg T C 6: 137,067,035 T28A possibly damaging Het
Rhcg A G 7: 79,599,468 I335T probably damaging Het
Rmnd1 C T 10: 4,403,873 V78I probably damaging Het
Ryr2 A C 13: 11,649,776 V3547G probably benign Het
Scnn1a C A 6: 125,337,807 Q324K probably benign Het
Serpinb6e G A 13: 33,832,715 T345I probably damaging Het
Smchd1 T C 17: 71,361,960 T1687A probably benign Het
Speer4f2 A C 5: 17,376,663 H201P Het
Spef2 G A 15: 9,725,171 R167C probably damaging Het
Srp68 A G 11: 116,271,907 probably null Het
Tbc1d14 A T 5: 36,512,540 F455I probably benign Het
Tet3 A G 6: 83,455,024 V10A possibly damaging Het
Tlr3 A T 8: 45,397,773 S696T probably benign Het
Tmem63b T C 17: 45,667,783 N300S probably benign Het
Tmprss11g T C 5: 86,489,291 I328M probably damaging Het
Tpm3 C T 3: 90,072,722 probably benign Het
Trim28 T A 7: 13,024,906 L63Q probably damaging Het
Unc5b G A 10: 60,777,486 R324C probably damaging Het
Vmn1r236 T A 17: 21,286,942 N107K possibly damaging Het
Vmn2r88 A G 14: 51,418,643 T770A Het
Zcchc2 C A 1: 106,030,481 P894Q probably damaging Het
Zfhx2 A G 14: 55,065,772 V1585A probably benign Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25992798 missense probably damaging 1.00
IGL01012:P3h2 APN 16 25987248 missense probably damaging 0.98
IGL02393:P3h2 APN 16 25992825 missense probably damaging 1.00
IGL02436:P3h2 APN 16 25997200 missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25984999 missense probably benign 0.01
R0319:P3h2 UTSW 16 25970931 missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25969950 missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25997248 missense probably benign
R1290:P3h2 UTSW 16 25987203 missense probably damaging 0.99
R1300:P3h2 UTSW 16 25997236 nonsense probably null
R1467:P3h2 UTSW 16 25965868 splice site probably benign
R1643:P3h2 UTSW 16 25972291 missense probably benign 0.00
R1645:P3h2 UTSW 16 25997232 missense probably damaging 1.00
R1761:P3h2 UTSW 16 25985050 missense probably damaging 0.96
R4227:P3h2 UTSW 16 26105453 missense probably benign
R4273:P3h2 UTSW 16 26105221 missense probably benign 0.00
R4409:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4410:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4653:P3h2 UTSW 16 26105277 missense probably damaging 0.98
R4968:P3h2 UTSW 16 25992662 critical splice donor site probably null
R5190:P3h2 UTSW 16 25984949 missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25981153 missense probably benign 0.01
R6225:P3h2 UTSW 16 25965743 missense probably damaging 0.97
R6838:P3h2 UTSW 16 26105284 missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25992745 missense probably damaging 1.00
R7445:P3h2 UTSW 16 25985065 missense probably damaging 0.96
R7753:P3h2 UTSW 16 25970937 missense probably damaging 1.00
R8166:P3h2 UTSW 16 25992822 missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25992718 missense probably damaging 0.98
R8442:P3h2 UTSW 16 25987205 missense probably benign 0.05
R8812:P3h2 UTSW 16 25982717 missense possibly damaging 0.67
R8965:P3h2 UTSW 16 25972384 missense probably benign 0.41
R9187:P3h2 UTSW 16 26105436 missense probably benign 0.27
R9193:P3h2 UTSW 16 26105241 missense probably benign 0.07
R9533:P3h2 UTSW 16 25970975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTACAAAACTTCCTTCCC -3'
(R):5'- TCAGTATTCCATTATGAGGACCCC -3'

Sequencing Primer
(F):5'- GCTTTCCCCAAATCTTACTGCAAAAG -3'
(R):5'- CCATTATGAGGACCCCCATTG -3'
Posted On 2019-05-15