Incidental Mutation 'R7089:P3h2'
ID 550109
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Name prolyl 3-hydroxylase 2
Synonyms Leprel1
MMRRC Submission 045183-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7089 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 25778038-25924534 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25784559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 645 (N645I)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
AlphaFold Q8CG71
Predicted Effect probably damaging
Transcript: ENSMUST00000039990
AA Change: N645I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: N645I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Meta Mutation Damage Score 0.5355 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,226,927 (GRCm39) V494A probably benign Het
1700017B05Rik A T 9: 57,166,041 (GRCm39) L111Q probably damaging Het
Adgrf4 T G 17: 42,977,424 (GRCm39) I640L possibly damaging Het
Afdn T G 17: 14,111,074 (GRCm39) probably null Het
Ammecr1l A T 18: 31,894,877 (GRCm39) probably benign Het
Aox1 A T 1: 58,375,808 (GRCm39) Y879F probably benign Het
Arhgap45 G A 10: 79,862,181 (GRCm39) probably null Het
Arpp21 G T 9: 111,955,514 (GRCm39) H542N probably benign Het
Ccdc192 C T 18: 57,725,059 (GRCm39) T96I probably benign Het
Cdt1 G A 8: 123,298,719 (GRCm39) R452Q probably damaging Het
Clcn7 C T 17: 25,372,667 (GRCm39) H149Y Het
Clpp T G 17: 57,297,421 (GRCm39) W32G probably benign Het
Dnmt1 G T 9: 20,819,785 (GRCm39) L1572M probably damaging Het
Drd3 G T 16: 43,627,741 (GRCm39) R128S probably damaging Het
Elmo2 A T 2: 165,146,849 (GRCm39) F243I possibly damaging Het
Endou G A 15: 97,618,126 (GRCm39) P128L probably benign Het
Fat3 A G 9: 15,908,214 (GRCm39) M2596T probably benign Het
Fbxl16 A G 17: 26,035,703 (GRCm39) K100R probably benign Het
Fbxo10 A G 4: 45,062,230 (GRCm39) S99P possibly damaging Het
Fez1 A T 9: 36,778,999 (GRCm39) R225S probably benign Het
Gm14326 A T 2: 177,588,464 (GRCm39) H177Q probably damaging Het
Gm32742 T A 9: 51,054,546 (GRCm39) M1360L probably benign Het
Hspg2 T C 4: 137,271,677 (GRCm39) V2481A possibly damaging Het
Ifnl3 A G 7: 28,223,283 (GRCm39) K101E probably benign Het
Il15 A T 8: 83,064,204 (GRCm39) S77R probably damaging Het
Ints13 T C 6: 146,476,216 (GRCm39) D95G probably damaging Het
Kcmf1 G A 6: 72,819,929 (GRCm39) P357S probably benign Het
Kcmf1 G T 6: 72,825,289 (GRCm39) T268K probably benign Het
Kmt2d A T 15: 98,748,153 (GRCm39) I3057N unknown Het
Lgi2 A G 5: 52,695,832 (GRCm39) F376L probably damaging Het
Lrig3 T G 10: 125,832,993 (GRCm39) L289R probably damaging Het
Mafk A G 5: 139,785,876 (GRCm39) S25G probably benign Het
Mpz T C 1: 170,987,204 (GRCm39) probably null Het
Nalcn A C 14: 123,515,761 (GRCm39) I1680R probably benign Het
Or13d1 C T 4: 52,971,470 (GRCm39) P283L probably damaging Het
Or5ak24 T A 2: 85,260,902 (GRCm39) K90N probably benign Het
Or5g26 C T 2: 85,494,518 (GRCm39) V87M possibly damaging Het
Or5p62 A T 7: 107,771,701 (GRCm39) N83K probably benign Het
Otof A C 5: 30,528,912 (GRCm39) I1827S possibly damaging Het
Oxgr1 A G 14: 120,259,614 (GRCm39) Y198H probably damaging Het
Pbld2 A G 10: 62,889,691 (GRCm39) T158A probably benign Het
Pdgfrb C T 18: 61,206,315 (GRCm39) R608C probably damaging Het
Pdia5 T C 16: 35,228,049 (GRCm39) T408A probably benign Het
Pik3cg A G 12: 32,226,845 (GRCm39) V1014A probably benign Het
Prpf8 A G 11: 75,399,374 (GRCm39) T2180A probably damaging Het
Rabgap1l A T 1: 160,551,742 (GRCm39) Y245* probably null Het
Rerg T C 6: 137,044,033 (GRCm39) T28A possibly damaging Het
Rhcg A G 7: 79,249,216 (GRCm39) I335T probably damaging Het
Rmnd1 C T 10: 4,353,873 (GRCm39) V78I probably damaging Het
Ryr2 A C 13: 11,664,662 (GRCm39) V3547G probably benign Het
Scnn1a C A 6: 125,314,770 (GRCm39) Q324K probably benign Het
Serpinb6e G A 13: 34,016,698 (GRCm39) T345I probably damaging Het
Smchd1 T C 17: 71,668,955 (GRCm39) T1687A probably benign Het
Smim45 A T 15: 82,136,774 (GRCm39) probably benign Het
Speer4f2 A C 5: 17,581,661 (GRCm39) H201P Het
Spef2 G A 15: 9,725,257 (GRCm39) R167C probably damaging Het
Srp68 A G 11: 116,162,733 (GRCm39) probably null Het
Tbc1d14 A T 5: 36,669,884 (GRCm39) F455I probably benign Het
Tet3 A G 6: 83,432,006 (GRCm39) V10A possibly damaging Het
Tlr3 A T 8: 45,850,810 (GRCm39) S696T probably benign Het
Tmem63b T C 17: 45,978,709 (GRCm39) N300S probably benign Het
Tmprss11g T C 5: 86,637,150 (GRCm39) I328M probably damaging Het
Tpm3 C T 3: 89,980,029 (GRCm39) probably benign Het
Trim28 T A 7: 12,758,833 (GRCm39) L63Q probably damaging Het
Unc5b G A 10: 60,613,265 (GRCm39) R324C probably damaging Het
Vmn1r236 T A 17: 21,507,204 (GRCm39) N107K possibly damaging Het
Vmn2r88 A G 14: 51,656,100 (GRCm39) T770A Het
Zcchc2 C A 1: 105,958,211 (GRCm39) P894Q probably damaging Het
Zfhx2 A G 14: 55,303,229 (GRCm39) V1585A probably benign Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25,811,548 (GRCm39) missense probably damaging 1.00
IGL01012:P3h2 APN 16 25,805,998 (GRCm39) missense probably damaging 0.98
IGL02393:P3h2 APN 16 25,811,575 (GRCm39) missense probably damaging 1.00
IGL02436:P3h2 APN 16 25,815,950 (GRCm39) missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25,803,749 (GRCm39) missense probably benign 0.01
R0319:P3h2 UTSW 16 25,789,681 (GRCm39) missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25,788,700 (GRCm39) missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25,815,998 (GRCm39) missense probably benign
R1290:P3h2 UTSW 16 25,805,953 (GRCm39) missense probably damaging 0.99
R1300:P3h2 UTSW 16 25,815,986 (GRCm39) nonsense probably null
R1467:P3h2 UTSW 16 25,784,618 (GRCm39) splice site probably benign
R1643:P3h2 UTSW 16 25,791,041 (GRCm39) missense probably benign 0.00
R1645:P3h2 UTSW 16 25,815,982 (GRCm39) missense probably damaging 1.00
R1761:P3h2 UTSW 16 25,803,800 (GRCm39) missense probably damaging 0.96
R4227:P3h2 UTSW 16 25,924,203 (GRCm39) missense probably benign
R4273:P3h2 UTSW 16 25,923,971 (GRCm39) missense probably benign 0.00
R4409:P3h2 UTSW 16 25,924,040 (GRCm39) missense possibly damaging 0.88
R4410:P3h2 UTSW 16 25,924,040 (GRCm39) missense possibly damaging 0.88
R4653:P3h2 UTSW 16 25,924,027 (GRCm39) missense probably damaging 0.98
R4968:P3h2 UTSW 16 25,811,412 (GRCm39) critical splice donor site probably null
R5190:P3h2 UTSW 16 25,803,699 (GRCm39) missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25,799,903 (GRCm39) missense probably benign 0.01
R6225:P3h2 UTSW 16 25,784,493 (GRCm39) missense probably damaging 0.97
R6838:P3h2 UTSW 16 25,924,034 (GRCm39) missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25,811,495 (GRCm39) missense probably damaging 1.00
R7445:P3h2 UTSW 16 25,803,815 (GRCm39) missense probably damaging 0.96
R7753:P3h2 UTSW 16 25,789,687 (GRCm39) missense probably damaging 1.00
R8166:P3h2 UTSW 16 25,811,572 (GRCm39) missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25,811,468 (GRCm39) missense probably damaging 0.98
R8442:P3h2 UTSW 16 25,805,955 (GRCm39) missense probably benign 0.05
R8812:P3h2 UTSW 16 25,801,467 (GRCm39) missense possibly damaging 0.67
R8965:P3h2 UTSW 16 25,791,134 (GRCm39) missense probably benign 0.41
R9187:P3h2 UTSW 16 25,924,186 (GRCm39) missense probably benign 0.27
R9193:P3h2 UTSW 16 25,923,991 (GRCm39) missense probably benign 0.07
R9533:P3h2 UTSW 16 25,789,725 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTACAAAACTTCCTTCCC -3'
(R):5'- TCAGTATTCCATTATGAGGACCCC -3'

Sequencing Primer
(F):5'- GCTTTCCCCAAATCTTACTGCAAAAG -3'
(R):5'- CCATTATGAGGACCCCCATTG -3'
Posted On 2019-05-15