Incidental Mutation 'R7089:Smchd1'
ID 550119
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms 4931400A14Rik, MommeD1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.769) question?
Stock # R7089 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 71344489-71475343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71361960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1687 (T1687A)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably benign
Transcript: ENSMUST00000127430
AA Change: T1687A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: T1687A

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik A T 15: 82,252,573 probably benign Het
1700010I14Rik T C 17: 9,008,095 V494A probably benign Het
1700011I03Rik C T 18: 57,591,987 T96I probably benign Het
1700017B05Rik A T 9: 57,258,758 L111Q probably damaging Het
Adgrf4 T G 17: 42,666,533 I640L possibly damaging Het
Afdn T G 17: 13,890,812 probably null Het
Ammecr1l A T 18: 31,761,824 probably benign Het
Aox2 A T 1: 58,336,649 Y879F probably benign Het
Arhgap45 G A 10: 80,026,347 probably null Het
Arpp21 G T 9: 112,126,446 H542N probably benign Het
Cdt1 G A 8: 122,571,980 R452Q probably damaging Het
Clcn7 C T 17: 25,153,693 H149Y Het
Clpp T G 17: 56,990,421 W32G probably benign Het
Dnmt1 G T 9: 20,908,489 L1572M probably damaging Het
Drd3 G T 16: 43,807,378 R128S probably damaging Het
Elmo2 A T 2: 165,304,929 F243I possibly damaging Het
Endou G A 15: 97,720,245 P128L probably benign Het
Fat3 A G 9: 15,996,918 M2596T probably benign Het
Fbxl16 A G 17: 25,816,729 K100R probably benign Het
Fbxo10 A G 4: 45,062,230 S99P possibly damaging Het
Fez1 A T 9: 36,867,703 R225S probably benign Het
Gm14326 A T 2: 177,946,671 H177Q probably damaging Het
Gm32742 T A 9: 51,143,246 M1360L probably benign Het
Hspg2 T C 4: 137,544,366 V2481A possibly damaging Het
Ifnl3 A G 7: 28,523,858 K101E probably benign Het
Il15 A T 8: 82,337,575 S77R probably damaging Het
Ints13 T C 6: 146,574,718 D95G probably damaging Het
Kcmf1 G A 6: 72,842,946 P357S probably benign Het
Kcmf1 G T 6: 72,848,306 T268K probably benign Het
Kmt2d A T 15: 98,850,272 I3057N unknown Het
Lgi2 A G 5: 52,538,490 F376L probably damaging Het
Lrig3 T G 10: 125,997,124 L289R probably damaging Het
Mafk A G 5: 139,800,121 S25G probably benign Het
Mpz T C 1: 171,159,635 probably null Het
Nalcn A C 14: 123,278,349 I1680R probably benign Het
Olfr154 C T 2: 85,664,174 V87M possibly damaging Het
Olfr270 C T 4: 52,971,470 P283L probably damaging Het
Olfr486 A T 7: 108,172,494 N83K probably benign Het
Olfr994 T A 2: 85,430,558 K90N probably benign Het
Otof A C 5: 30,371,568 I1827S possibly damaging Het
Oxgr1 A G 14: 120,022,202 Y198H probably damaging Het
P3h2 T A 16: 25,965,809 N645I probably damaging Het
Pbld2 A G 10: 63,053,912 T158A probably benign Het
Pdgfrb C T 18: 61,073,243 R608C probably damaging Het
Pdia5 T C 16: 35,407,679 T408A probably benign Het
Pik3cg A G 12: 32,176,846 V1014A probably benign Het
Prpf8 A G 11: 75,508,548 T2180A probably damaging Het
Rabgap1l A T 1: 160,724,172 Y245* probably null Het
Rerg T C 6: 137,067,035 T28A possibly damaging Het
Rhcg A G 7: 79,599,468 I335T probably damaging Het
Rmnd1 C T 10: 4,403,873 V78I probably damaging Het
Ryr2 A C 13: 11,649,776 V3547G probably benign Het
Scnn1a C A 6: 125,337,807 Q324K probably benign Het
Serpinb6e G A 13: 33,832,715 T345I probably damaging Het
Speer4f2 A C 5: 17,376,663 H201P Het
Spef2 G A 15: 9,725,171 R167C probably damaging Het
Srp68 A G 11: 116,271,907 probably null Het
Tbc1d14 A T 5: 36,512,540 F455I probably benign Het
Tet3 A G 6: 83,455,024 V10A possibly damaging Het
Tlr3 A T 8: 45,397,773 S696T probably benign Het
Tmem63b T C 17: 45,667,783 N300S probably benign Het
Tmprss11g T C 5: 86,489,291 I328M probably damaging Het
Tpm3 C T 3: 90,072,722 probably benign Het
Trim28 T A 7: 13,024,906 L63Q probably damaging Het
Unc5b G A 10: 60,777,486 R324C probably damaging Het
Vmn1r236 T A 17: 21,286,942 N107K possibly damaging Het
Vmn2r88 A G 14: 51,418,643 T770A Het
Zcchc2 C A 1: 106,030,481 P894Q probably damaging Het
Zfhx2 A G 14: 55,065,772 V1585A probably benign Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
Dry_tortugas UTSW 17 71440956 missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
R8948:Smchd1 UTSW 17 71436772 missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71448757 missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71394715 critical splice donor site probably null
R9054:Smchd1 UTSW 17 71363022 nonsense probably null
R9141:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9169:Smchd1 UTSW 17 71415664 missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71365089 missense probably benign 0.05
R9368:Smchd1 UTSW 17 71387076 missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71411848 missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71394796 missense probably benign 0.27
R9426:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9491:Smchd1 UTSW 17 71360025 critical splice donor site probably null
R9511:Smchd1 UTSW 17 71443904 missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTCTACACAACACAAGGT -3'
(R):5'- GTGGTAGGAGTACTGCTGTAGC -3'

Sequencing Primer
(F):5'- CACAAGGTAACAAGATGTACTGTTTC -3'
(R):5'- GCTGTAGCATGCCATGGTC -3'
Posted On 2019-05-15