Mutagenetix > Incidental Mutations

Incidental Mutation 'R7090:Lpin3'

550133

Institutional Source

Beutler Lab

Gene Symbol

Lpin3

Ensembl Gene

ENSMUSG00000027412

Gene Name

lipin 3

Synonyms

9130206L11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7090 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

160880670-160906002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 160896752 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 208 (L208R)

Ref Sequence

ENSEMBL: ENSMUSP00000105083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040872
AA Change: L208R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: L208R

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109455
AA Change: L208R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: L208R

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.4e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	528	538	N/A	INTRINSIC
LNS2	606	762	1.4e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109456
AA Change: L208R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: L208R

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109457
AA Change: L208R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: L208R

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	4.1e-48	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
Pfam:Lipin_mid	435	538	9.5e-35	PFAM
low complexity region	569	579	N/A	INTRINSIC
LNS2	647	803	1.4e-105	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Calm3	A	T	7: 16,917,079	Y139*	probably null	Het
Ccdc27	T	C	4: 154,028,066	N584S	probably benign	Het
Cdh24	C	G	14: 54,639,507	G13A	probably damaging	Het
Chd8	T	C	14: 52,215,220	K1281E	probably damaging	Het
Clasp1	G	T	1: 118,482,086	G4C	probably benign	Het
Cul9	G	T	17: 46,500,839	P2488T	probably damaging	Het
Daam2	A	G	17: 49,482,945	V428A	probably damaging	Het
Dcaf8	A	G	1: 172,188,968	S441G	probably damaging	Het
Dchs2	A	G	3: 83,348,274	T2426A	probably benign	Het
Dpys	A	G	15: 39,826,883	V358A	probably damaging	Het
Efhd1	A	G	1: 87,289,497	D112G	probably damaging	Het
Exoc1	T	C	5: 76,566,953	S120P	unknown	Het
Fyco1	A	G	9: 123,797,719	L1309S	probably damaging	Het
Gm14403	A	G	2: 177,509,321	N111S	possibly damaging	Het
Gm5901	A	G	7: 105,377,348	T108A	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Kcnk15	T	C	2: 163,858,717	V292A	probably benign	Het
Kdm2a	A	T	19: 4,319,141	Y1149N	probably damaging	Het
Kdm3a	T	C	6: 71,595,545	T1011A	possibly damaging	Het
Krt35	A	T	11: 100,095,672		probably null	Het
Lipn	T	A	19: 34,071,780	D115E	possibly damaging	Het
Ltf	C	A	9: 111,025,980	Q354K	probably benign	Het
Marf1	C	A	16: 14,111,702	C1680F	possibly damaging	Het
Mtss1l	T	A	8: 110,730,024	V242E	probably damaging	Het
Myo7b	T	C	18: 31,998,712	Y477C	probably damaging	Het
Nbn	T	A	4: 15,981,350	S481T	probably benign	Het
Ncoa2	A	G	1: 13,186,838	Y146H	probably damaging	Het
Ntng1	A	T	3: 109,935,180	C92*	probably null	Het
Olfr1049	T	A	2: 86,255,076	N206Y	probably damaging	Het
Olfr1077-ps1	T	C	2: 86,526,127	I17V	probably benign	Het
Olfr133	G	A	17: 38,149,494	G302D	probably benign	Het
Olfr286	C	T	15: 98,227,202	V150I	probably benign	Het
Os9	A	T	10: 127,099,678	S308T	probably benign	Het
Otx2	T	A	14: 48,658,735	T289S	probably benign	Het
Palm2	C	T	4: 57,648,042	A60V	probably benign	Het
Pigg	A	G	5: 108,336,512	T675A	possibly damaging	Het
Pink1	C	T	4: 138,315,601	E461K	probably damaging	Het
Pip5k1a	A	G	3: 95,060,498	S543P	possibly damaging	Het
Prkaa1	A	G	15: 5,177,130	T454A	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rab31	C	T	17: 65,698,017	V83I	possibly damaging	Het
Rabggtb	G	T	3: 153,910,349	D117E	probably benign	Het
Rbl1	T	C	2: 157,152,900	H951R	probably benign	Het
Sapcd2	A	G	2: 25,376,079	S314G	probably benign	Het
Sept4	T	C	11: 87,584,438	L164P	probably damaging	Het
Shroom1	A	G	11: 53,465,933	E541G	probably damaging	Het
Slc26a7	C	A	4: 14,565,460	G208*	probably null	Het
Smco2	A	G	6: 146,871,213	I304M	probably damaging	Het
Spg7	T	C	8: 123,091,752		probably null	Het
Spocd1	T	C	4: 129,953,898	F552L		Het
St6galnac2	T	C	11: 116,677,635	D334G	probably damaging	Het
Sub1	A	G	15: 11,986,486	S92P	probably benign	Het
Syne2	T	C	12: 75,942,351	F1829L	probably benign	Het
Tdrd1	T	C	19: 56,851,401	V631A	probably benign	Het
Tdrd9	T	C	12: 111,992,470	S113P	probably benign	Het
Tgfbrap1	A	C	1: 43,071,565	V260G	probably damaging	Het
Tyw3	G	C	3: 154,593,789	S94R	probably benign	Het
Urb2	T	C	8: 124,030,599	V1015A	probably benign	Het
Usp5	A	G	6: 124,829,394	M1T	probably null	Het
Utrn	T	C	10: 12,684,516	D1343G	possibly damaging	Het
Vmn2r56	T	C	7: 12,715,327	Y328C	probably damaging	Het
Vmn2r99	A	T	17: 19,393,710	E564V	possibly damaging	Het
Wdr63	C	A	3: 146,040,827	K881N	possibly damaging	Het
Zc3h8	T	C	2: 128,935,321	T133A	possibly damaging	Het

Other mutations in Lpin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Lpin3	APN	2	160893998	missense	probably damaging	1.00
IGL01373:Lpin3	APN	2	160903729	missense	probably damaging	1.00
IGL01576:Lpin3	APN	2	160897127	missense	probably benign	0.02
IGL02124:Lpin3	APN	2	160895833	critical splice donor site	probably null
IGL02272:Lpin3	APN	2	160901661	missense	probably benign	0.15
IGL02314:Lpin3	APN	2	160898718	nonsense	probably null
IGL02374:Lpin3	APN	2	160895838	splice site	probably benign
IGL02554:Lpin3	APN	2	160896787	missense	probably damaging	1.00
IGL02693:Lpin3	APN	2	160905055	missense	probably damaging	1.00
IGL02858:Lpin3	APN	2	160898620	splice site	probably benign
IGL03143:Lpin3	APN	2	160903598	splice site	probably benign
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0329:Lpin3	UTSW	2	160905305	missense	probably benign
R0330:Lpin3	UTSW	2	160905305	missense	probably benign
R0570:Lpin3	UTSW	2	160904024	splice site	probably benign
R0633:Lpin3	UTSW	2	160903974	missense	probably damaging	0.99
R0781:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1109:Lpin3	UTSW	2	160899021	missense	probably damaging	1.00
R1110:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1513:Lpin3	UTSW	2	160904548	missense	probably damaging	1.00
R1543:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R1785:Lpin3	UTSW	2	160896809	nonsense	probably null
R1786:Lpin3	UTSW	2	160896809	nonsense	probably null
R1896:Lpin3	UTSW	2	160905298	missense	probably damaging	1.00
R4440:Lpin3	UTSW	2	160898645	missense	probably benign
R4470:Lpin3	UTSW	2	160895434	missense	probably benign	0.00
R4996:Lpin3	UTSW	2	160905287	missense	probably damaging	1.00
R5014:Lpin3	UTSW	2	160904828	missense	probably damaging	1.00
R5124:Lpin3	UTSW	2	160897061	missense	probably benign
R5184:Lpin3	UTSW	2	160897138	missense	probably benign
R5405:Lpin3	UTSW	2	160903929	missense	probably damaging	1.00
R5442:Lpin3	UTSW	2	160905016	missense	probably damaging	1.00
R5666:Lpin3	UTSW	2	160897330	missense	probably benign
R5670:Lpin3	UTSW	2	160897330	missense	probably benign
R5693:Lpin3	UTSW	2	160895400	missense	probably benign	0.00
R6084:Lpin3	UTSW	2	160895801	missense	probably benign	0.38
R6994:Lpin3	UTSW	2	160904883	missense	probably damaging	1.00
R7157:Lpin3	UTSW	2	160898707	missense	probably benign	0.02
R7207:Lpin3	UTSW	2	160894003	nonsense	probably null
R7430:Lpin3	UTSW	2	160898666	missense	probably benign	0.06
R7459:Lpin3	UTSW	2	160897300	missense	probably benign	0.06
R7644:Lpin3	UTSW	2	160896770	missense	probably benign	0.02
R7706:Lpin3	UTSW	2	160905290	missense	probably damaging	1.00
R7803:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
X0002:Lpin3	UTSW	2	160903717	missense	probably damaging	1.00
Z1088:Lpin3	UTSW	2	160892231	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCACAGAAGTTACATCTTGCC -3'
(R):5'- AATCCTGATGCAGAGGGACC -3'

Sequencing Primer
(F):5'- CGCTCCTTATGTGACAGCAGATG -3'
(R):5'- CAGAGGGACCAGGGAGTCC -3'

Posted On

2019-05-15