Incidental Mutation 'R7090:Spocd1'
ID550145
Institutional Source Beutler Lab
Gene Symbol Spocd1
Ensembl Gene ENSMUSG00000028784
Gene NameSPOC domain containing 1
SynonymsOTTMUSG00000009522
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7090 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129929249-129957115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129953898 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 552 (F552L)
Ref Sequence ENSEMBL: ENSMUSP00000081284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084263] [ENSMUST00000128007]
Predicted Effect
SMART Domains Protein: ENSMUSP00000081284
Gene: ENSMUSG00000028784
AA Change: F552L

DomainStartEndE-ValueType
Pfam:TFIIS_M 1 105 1.7e-24 PFAM
Blast:PAC 123 163 4e-7 BLAST
Pfam:SPOC 247 350 1e-22 PFAM
low complexity region 454 467 N/A INTRINSIC
low complexity region 559 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128007
SMART Domains Protein: ENSMUSP00000118383
Gene: ENSMUSG00000028784

DomainStartEndE-ValueType
Pfam:TFIIS_M 5 113 3.6e-28 PFAM
Blast:PAC 129 157 6e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TFIIS family of transcription factors. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Spocd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Spocd1 APN 4 129953587 missense probably damaging 0.99
IGL02332:Spocd1 APN 4 129949092 missense probably damaging 1.00
IGL02796:Spocd1 APN 4 129947755 intron probably benign
R0005:Spocd1 UTSW 4 129956778 missense possibly damaging 0.73
R0499:Spocd1 UTSW 4 129955470 missense possibly damaging 0.56
R0939:Spocd1 UTSW 4 129948870 missense possibly damaging 0.93
R1128:Spocd1 UTSW 4 129956806 missense possibly damaging 0.57
R5747:Spocd1 UTSW 4 129954945 missense probably damaging 1.00
R5774:Spocd1 UTSW 4 129951786 missense probably benign 0.04
R5872:Spocd1 UTSW 4 129956461 missense probably damaging 0.99
R5887:Spocd1 UTSW 4 129948959 missense probably damaging 1.00
R6185:Spocd1 UTSW 4 129956449 missense probably benign 0.02
R6198:Spocd1 UTSW 4 129955415 missense probably damaging 1.00
R6245:Spocd1 UTSW 4 129957108 unclassified probably null
R6412:Spocd1 UTSW 4 129953572 missense probably benign 0.44
R6804:Spocd1 UTSW 4 129953630 nonsense probably null
R6884:Spocd1 UTSW 4 129955404 unclassified probably benign
R6898:Spocd1 UTSW 4 129956512 unclassified probably benign
R7548:Spocd1 UTSW 4 129929809 missense
R7570:Spocd1 UTSW 4 129930164 missense
R7657:Spocd1 UTSW 4 129929742 missense
R7910:Spocd1 UTSW 4 129930100 missense
R7991:Spocd1 UTSW 4 129930100 missense
Z1177:Spocd1 UTSW 4 129929977 missense
Z1177:Spocd1 UTSW 4 129955513 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGGGTTTGTAAGCAGCAG -3'
(R):5'- GGTCATAAAGGAAGGACGCTCC -3'

Sequencing Primer
(F):5'- AGAATGGGAGATCCTATGCCCTC -3'
(R):5'- ACGCTCCTGCAGTGTGTG -3'
Posted On2019-05-15