Incidental Mutation 'R7090:Shroom1'
ID 550164
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Name shroom family member 1
Synonyms Shrm1, Apx, 1300007L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7090 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53457205-53467766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53465933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 541 (E541G)
Ref Sequence ENSEMBL: ENSMUSP00000104641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000057722] [ENSMUST00000093114] [ENSMUST00000109013]
AlphaFold Q5SX79
Predicted Effect probably damaging
Transcript: ENSMUST00000018531
AA Change: E478G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: E478G

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057722
Predicted Effect probably damaging
Transcript: ENSMUST00000093114
AA Change: E541G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: E541G

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109013
AA Change: E541G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: E541G

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Meta Mutation Damage Score 0.6712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53464094 missense probably benign 0.00
IGL00985:Shroom1 APN 11 53465969 missense probably benign
IGL01111:Shroom1 APN 11 53464048 missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53465558 missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53466559 missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53463379 missense probably benign
bracket UTSW 11 53463982 nonsense probably null
shitake UTSW 11 53465722 missense possibly damaging 0.91
R0083:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0357:Shroom1 UTSW 11 53465208 missense probably damaging 0.96
R0661:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R1875:Shroom1 UTSW 11 53465675 missense probably damaging 0.99
R2356:Shroom1 UTSW 11 53466447 missense probably benign 0.05
R4657:Shroom1 UTSW 11 53465588 missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53466462 missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53465722 missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53465233 missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53465139 missense probably benign 0.07
R4964:Shroom1 UTSW 11 53465172 missense probably benign
R5000:Shroom1 UTSW 11 53467117 utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53464045 missense probably benign 0.00
R5141:Shroom1 UTSW 11 53463982 nonsense probably null
R5256:Shroom1 UTSW 11 53465507 missense probably benign 0.32
R5273:Shroom1 UTSW 11 53463844 missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53463922 missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53463991 missense probably benign 0.00
R6058:Shroom1 UTSW 11 53463481 missense possibly damaging 0.83
R6408:Shroom1 UTSW 11 53463387 missense probably benign 0.00
R6677:Shroom1 UTSW 11 53463516 missense possibly damaging 0.85
R7369:Shroom1 UTSW 11 53465248 missense probably benign 0.43
R7654:Shroom1 UTSW 11 53466908 missense probably benign 0.02
R7919:Shroom1 UTSW 11 53463393 missense probably benign 0.17
R7964:Shroom1 UTSW 11 53464322 missense possibly damaging 0.94
R8338:Shroom1 UTSW 11 53463280 missense probably benign 0.08
R8365:Shroom1 UTSW 11 53465641 nonsense probably null
R8386:Shroom1 UTSW 11 53466403 missense probably damaging 1.00
R8971:Shroom1 UTSW 11 53465167 missense probably damaging 0.99
R9116:Shroom1 UTSW 11 53463663 missense probably damaging 1.00
R9392:Shroom1 UTSW 11 53463847 missense possibly damaging 0.91
R9410:Shroom1 UTSW 11 53463390 missense probably damaging 1.00
R9577:Shroom1 UTSW 11 53466785 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCTTCAGACTCTGAGACTCC -3'
(R):5'- TCTTGGGAAGTCTGCAGGTC -3'

Sequencing Primer
(F):5'- TCTGAGACTCCAGGGTCCC -3'
(R):5'- TGGTGTCCACAAGACCTGAG -3'
Posted On 2019-05-15