Incidental Mutation 'R7090:Sept4'
ID550165
Institutional Source Beutler Lab
Gene Symbol Sept4
Ensembl Gene ENSMUSG00000020486
Gene Nameseptin 4
Synonymscell division control-related protein 2b, ARTS, Pnutl2, septin H5, Bh5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R7090 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87568903-87590539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87584438 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 164 (L164P)
Ref Sequence ENSEMBL: ENSMUSP00000018544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000122067] [ENSMUST00000122945] [ENSMUST00000133202]
Predicted Effect probably damaging
Transcript: ENSMUST00000018544
AA Change: L164P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: L164P

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063156
AA Change: L65P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: L65P

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107960
AA Change: L164P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486
AA Change: L164P

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107961
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486
AA Change: L58P

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107962
AA Change: L145P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: L145P

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122067
AA Change: L46P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486
AA Change: L46P

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122945
AA Change: L157P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486
AA Change: L157P

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133202
AA Change: L154P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486
AA Change: L154P

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Meta Mutation Damage Score 0.9535 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Sept4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Sept4 APN 11 87589773 missense probably damaging 1.00
IGL00963:Sept4 APN 11 87583373 missense possibly damaging 0.89
IGL03087:Sept4 APN 11 87585245 splice site probably benign
IGL03268:Sept4 APN 11 87589703 missense probably damaging 0.99
R0077:Sept4 UTSW 11 87581196 missense probably benign
R1729:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1730:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1739:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1762:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1783:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1784:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1785:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1957:Sept4 UTSW 11 87590367 missense probably benign 0.02
R2131:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2133:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2140:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2141:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2252:Sept4 UTSW 11 87589811 missense possibly damaging 0.75
R3696:Sept4 UTSW 11 87585234 missense possibly damaging 0.48
R4018:Sept4 UTSW 11 87585121 missense probably damaging 1.00
R4193:Sept4 UTSW 11 87583316 critical splice acceptor site probably null
R4196:Sept4 UTSW 11 87588772 missense probably damaging 0.96
R5012:Sept4 UTSW 11 87584404 missense possibly damaging 0.78
R5149:Sept4 UTSW 11 87589245 missense probably damaging 1.00
R5891:Sept4 UTSW 11 87588924 unclassified probably benign
R6090:Sept4 UTSW 11 87589517 missense possibly damaging 0.48
R6145:Sept4 UTSW 11 87585246 splice site probably null
R6257:Sept4 UTSW 11 87590349 missense probably benign 0.07
R6704:Sept4 UTSW 11 87589030 missense probably damaging 1.00
R7064:Sept4 UTSW 11 87590367 missense probably benign 0.02
R7784:Sept4 UTSW 11 87579008 missense probably benign
R7790:Sept4 UTSW 11 87589239 missense probably damaging 1.00
R8320:Sept4 UTSW 11 87589734 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CATTCAATCAAGAAGGCTGTACAAG -3'
(R):5'- GCATCCAGATCTTTAGGGAGC -3'

Sequencing Primer
(F):5'- AGGCTGTACAAGTTTCCAGC -3'
(R):5'- TGAACTTGCCAGGCCAGATAG -3'
Posted On2019-05-15