Incidental Mutation 'R7090:St6galnac2'
ID550166
Institutional Source Beutler Lab
Gene Symbol St6galnac2
Ensembl Gene ENSMUSG00000110170
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
SynonymsSiat7b, ST6GalNAc II, Siat7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R7090 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116677483-116681290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116677635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 334 (D334G)
Ref Sequence ENSEMBL: ENSMUSP00000078501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079545] [ENSMUST00000106378] [ENSMUST00000134818] [ENSMUST00000139934] [ENSMUST00000142834] [ENSMUST00000144049] [ENSMUST00000144398]
Predicted Effect probably damaging
Transcript: ENSMUST00000079545
AA Change: D334G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078501
Gene: ENSMUSG00000057286
AA Change: D334G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_29 90 373 2.9e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106378
Predicted Effect probably benign
Transcript: ENSMUST00000131260
Predicted Effect probably benign
Transcript: ENSMUST00000134818
Predicted Effect probably benign
Transcript: ENSMUST00000139934
Predicted Effect probably benign
Transcript: ENSMUST00000142834
Predicted Effect probably benign
Transcript: ENSMUST00000144049
SMART Domains Protein: ENSMUSP00000131548
Gene: ENSMUSG00000020812

DomainStartEndE-ValueType
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144398
Meta Mutation Damage Score 0.2785 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ST6GALNAC2 belongs to a family of sialyltransferases that add sialic acids to the nonreducing ends of glycoconjugates. At the cell surface, these modifications have roles in cell-cell and cell-substrate interactions, bacterial adhesion, and protein targeting (Samyn-Petit et al., 2000 [PubMed 10742600]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased body weight, decreased IgQ, increased B cell proliferation, increased pre-B cell number, abnormal erythropoiesis, increased ALT, decreased creatinine level and prominent spleen germinal center. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in St6galnac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01726:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01727:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL01733:St6galnac2 APN 11 116685119 missense probably damaging 1.00
IGL03353:St6galnac2 APN 11 116690302 splice site probably benign
R1521:St6galnac2 UTSW 11 116684347 missense possibly damaging 0.79
R1524:St6galnac2 UTSW 11 116684487 unclassified probably benign
R1855:St6galnac2 UTSW 11 116690315 missense probably benign 0.02
R2307:St6galnac2 UTSW 11 116681905 missense probably damaging 1.00
R4079:St6galnac2 UTSW 11 116681898 missense possibly damaging 0.69
R4658:St6galnac2 UTSW 11 116684525 unclassified probably benign
R5174:St6galnac2 UTSW 11 116681947 missense probably damaging 0.99
R5436:St6galnac2 UTSW 11 116684527 unclassified probably benign
R5655:St6galnac2 UTSW 11 116685146 missense probably damaging 1.00
R6584:St6galnac2 UTSW 11 116694504 missense probably benign 0.06
R6702:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R6703:St6galnac2 UTSW 11 116684387 missense probably benign 0.38
R7368:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7607:St6galnac2 UTSW 11 116679979 missense probably damaging 1.00
R7728:St6galnac2 UTSW 11 116679985 missense probably benign 0.02
R7751:St6galnac2 UTSW 11 116677584 missense probably damaging 1.00
R7851:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
R7934:St6galnac2 UTSW 11 116685938 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTTGCCTCTTCCAGAAGTTG -3'
(R):5'- GTTGGACGGGGTTAAGACTCATC -3'

Sequencing Primer
(F):5'- GCCTCTTCCAGAAGTTGAAAGGTC -3'
(R):5'- CTTTGAGAATGTGTACAAAGGACAC -3'
Posted On2019-05-15