Incidental Mutation 'R7090:Ptk2'
ID 550175
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene Name PTK2 protein tyrosine kinase 2
Synonyms FRNK, FAK, Fadk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7090 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 73205102-73423280 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73221809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 854 (P854S)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]
AlphaFold P34152
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
R8057:Ptk2 UTSW 15 73298199 frame shift probably null
R8235:Ptk2 UTSW 15 73343291 missense probably benign 0.00
R9106:Ptk2 UTSW 15 73259608 missense possibly damaging 0.95
R9160:Ptk2 UTSW 15 73216084 missense probably benign 0.01
R9301:Ptk2 UTSW 15 73274497 missense probably damaging 1.00
R9448:Ptk2 UTSW 15 73343192 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTGATCTGCATCTATGAAAATCTGG -3'
(R):5'- ACTTGGGAGCAGTGTCACAG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'
Posted On 2019-05-15