Mutagenetix > Incidental Mutation

Incidental Mutation 'R7090:Ptk2'

550175

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7090 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73221809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 854 (P854S)

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

AlphaFold

P34152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Calm3	A	T	7: 16,917,079	Y139*	probably null	Het
Ccdc27	T	C	4: 154,028,066	N584S	probably benign	Het
Cdh24	C	G	14: 54,639,507	G13A	probably damaging	Het
Chd8	T	C	14: 52,215,220	K1281E	probably damaging	Het
Clasp1	G	T	1: 118,482,086	G4C	probably benign	Het
Cul9	G	T	17: 46,500,839	P2488T	probably damaging	Het
Daam2	A	G	17: 49,482,945	V428A	probably damaging	Het
Dcaf8	A	G	1: 172,188,968	S441G	probably damaging	Het
Dchs2	A	G	3: 83,348,274	T2426A	probably benign	Het
Dpys	A	G	15: 39,826,883	V358A	probably damaging	Het
Efhd1	A	G	1: 87,289,497	D112G	probably damaging	Het
Exoc1	T	C	5: 76,566,953	S120P	unknown	Het
Fyco1	A	G	9: 123,797,719	L1309S	probably damaging	Het
Gm14403	A	G	2: 177,509,321	N111S	possibly damaging	Het
Gm5901	A	G	7: 105,377,348	T108A	probably benign	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Itgb5	T	G	16: 33,885,094	D251E	probably damaging	Het
Kcnk15	T	C	2: 163,858,717	V292A	probably benign	Het
Kdm2a	A	T	19: 4,319,141	Y1149N	probably damaging	Het
Kdm3a	T	C	6: 71,595,545	T1011A	possibly damaging	Het
Krt35	A	T	11: 100,095,672		probably null	Het
Lipn	T	A	19: 34,071,780	D115E	possibly damaging	Het
Lpin3	T	G	2: 160,896,752	L208R	probably damaging	Het
Ltf	C	A	9: 111,025,980	Q354K	probably benign	Het
Marf1	C	A	16: 14,111,702	C1680F	possibly damaging	Het
Mtss1l	T	A	8: 110,730,024	V242E	probably damaging	Het
Myo7b	T	C	18: 31,998,712	Y477C	probably damaging	Het
Nbn	T	A	4: 15,981,350	S481T	probably benign	Het
Ncoa2	A	G	1: 13,186,838	Y146H	probably damaging	Het
Ntng1	A	T	3: 109,935,180	C92*	probably null	Het
Olfr1049	T	A	2: 86,255,076	N206Y	probably damaging	Het
Olfr1077-ps1	T	C	2: 86,526,127	I17V	probably benign	Het
Olfr133	G	A	17: 38,149,494	G302D	probably benign	Het
Olfr286	C	T	15: 98,227,202	V150I	probably benign	Het
Os9	A	T	10: 127,099,678	S308T	probably benign	Het
Otx2	T	A	14: 48,658,735	T289S	probably benign	Het
Palm2	C	T	4: 57,648,042	A60V	probably benign	Het
Pigg	A	G	5: 108,336,512	T675A	possibly damaging	Het
Pink1	C	T	4: 138,315,601	E461K	probably damaging	Het
Pip5k1a	A	G	3: 95,060,498	S543P	possibly damaging	Het
Prkaa1	A	G	15: 5,177,130	T454A	probably benign	Het
Rab31	C	T	17: 65,698,017	V83I	possibly damaging	Het
Rabggtb	G	T	3: 153,910,349	D117E	probably benign	Het
Rbl1	T	C	2: 157,152,900	H951R	probably benign	Het
Sapcd2	A	G	2: 25,376,079	S314G	probably benign	Het
Sept4	T	C	11: 87,584,438	L164P	probably damaging	Het
Shroom1	A	G	11: 53,465,933	E541G	probably damaging	Het
Slc26a7	C	A	4: 14,565,460	G208*	probably null	Het
Smco2	A	G	6: 146,871,213	I304M	probably damaging	Het
Spg7	T	C	8: 123,091,752		probably null	Het
Spocd1	T	C	4: 129,953,898	F552L		Het
St6galnac2	T	C	11: 116,677,635	D334G	probably damaging	Het
Sub1	A	G	15: 11,986,486	S92P	probably benign	Het
Syne2	T	C	12: 75,942,351	F1829L	probably benign	Het
Tdrd1	T	C	19: 56,851,401	V631A	probably benign	Het
Tdrd9	T	C	12: 111,992,470	S113P	probably benign	Het
Tgfbrap1	A	C	1: 43,071,565	V260G	probably damaging	Het
Tyw3	G	C	3: 154,593,789	S94R	probably benign	Het
Urb2	T	C	8: 124,030,599	V1015A	probably benign	Het
Usp5	A	G	6: 124,829,394	M1T	probably null	Het
Utrn	T	C	10: 12,684,516	D1343G	possibly damaging	Het
Vmn2r56	T	C	7: 12,715,327	Y328C	probably damaging	Het
Vmn2r99	A	T	17: 19,393,710	E564V	possibly damaging	Het
Wdr63	C	A	3: 146,040,827	K881N	possibly damaging	Het
Zc3h8	T	C	2: 128,935,321	T133A	possibly damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73259608	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73216084	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73274497	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73343192	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GTGATCTGCATCTATGAAAATCTGG -3'
(R):5'- ACTTGGGAGCAGTGTCACAG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'

Posted On

2019-05-15