Incidental Mutation 'R7090:Olfr133'
ID550180
Institutional Source Beutler Lab
Gene Symbol Olfr133
Ensembl Gene ENSMUSG00000063240
Gene Nameolfactory receptor 133
SynonymsGA_x6K02T2PSCP-2597192-2598130, MOR256-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7090 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location38145281-38151269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38149494 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 302 (G302D)
Ref Sequence ENSEMBL: ENSMUSP00000149451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113636] [ENSMUST00000173610] [ENSMUST00000215078] [ENSMUST00000215549]
Predicted Effect probably benign
Transcript: ENSMUST00000113636
AA Change: G302D

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109266
Gene: ENSMUSG00000063240
AA Change: G302D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 27 305 3.4e-7 PFAM
Pfam:7tm_4 31 308 6.1e-52 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173610
SMART Domains Protein: ENSMUSP00000133824
Gene: ENSMUSG00000063240

DomainStartEndE-ValueType
Pfam:7tm_1 55 109 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215078
AA Change: G302D

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000215549
AA Change: G302D

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Olfr133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Olfr133 APN 17 38148855 missense probably benign
IGL02486:Olfr133 APN 17 38149221 missense probably damaging 1.00
IGL02574:Olfr133 APN 17 38149389 missense possibly damaging 0.56
PIT4243001:Olfr133 UTSW 17 38149503 missense probably benign 0.06
PIT4504001:Olfr133 UTSW 17 38149169 missense probably benign
R0726:Olfr133 UTSW 17 38148624 missense probably damaging 1.00
R2242:Olfr133 UTSW 17 38148722 missense possibly damaging 0.87
R2496:Olfr133 UTSW 17 38149431 missense possibly damaging 0.91
R4579:Olfr133 UTSW 17 38149405 missense probably damaging 1.00
R5085:Olfr133 UTSW 17 38149112 missense probably damaging 1.00
R6273:Olfr133 UTSW 17 38148942 missense possibly damaging 0.94
R6344:Olfr133 UTSW 17 38148720 missense probably benign 0.01
R7046:Olfr133 UTSW 17 38148800 missense probably benign 0.00
R7213:Olfr133 UTSW 17 38149074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCCTTTGGGACATGTTCC -3'
(R):5'- CTATCCAAGATCAACCATTGCCTAG -3'

Sequencing Primer
(F):5'- GGGACATGTTCCTCTCATCTCATTG -3'
(R):5'- CAACCATTGCCTAGCATAATTAGG -3'
Posted On2019-05-15