Incidental Mutation 'R7090:Daam2'
ID550182
Institutional Source Beutler Lab
Gene Symbol Daam2
Ensembl Gene ENSMUSG00000040260
Gene Namedishevelled associated activator of morphogenesis 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7090 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location49456022-49564343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49482945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 428 (V428A)
Ref Sequence ENSEMBL: ENSMUSP00000052085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057610] [ENSMUST00000224595]
Predicted Effect probably damaging
Transcript: ENSMUST00000057610
AA Change: V428A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260
AA Change: V428A

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224595
AA Change: V428A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.4399 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous KO in combination with homozygous Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lipn T A 19: 34,071,780 D115E possibly damaging Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Daam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Daam2 APN 17 49490304 missense possibly damaging 0.82
IGL02373:Daam2 APN 17 49473380 missense probably damaging 1.00
IGL02626:Daam2 APN 17 49490254 missense possibly damaging 0.46
IGL02793:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL02861:Daam2 APN 17 49469427 missense probably damaging 1.00
IGL02875:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL03370:Daam2 APN 17 49486501 missense probably benign 0.19
R0145:Daam2 UTSW 17 49480778 missense probably benign
R0310:Daam2 UTSW 17 49463924 critical splice donor site probably null
R0362:Daam2 UTSW 17 49480785 splice site probably null
R0423:Daam2 UTSW 17 49469421 nonsense probably null
R0883:Daam2 UTSW 17 49498883 utr 5 prime probably benign
R0928:Daam2 UTSW 17 49488227 missense probably benign 0.30
R1444:Daam2 UTSW 17 49480751 missense possibly damaging 0.89
R1559:Daam2 UTSW 17 49496120 splice site probably benign
R1733:Daam2 UTSW 17 49490203 missense possibly damaging 0.60
R1919:Daam2 UTSW 17 49485457 missense probably benign 0.00
R1930:Daam2 UTSW 17 49462213 splice site probably null
R1968:Daam2 UTSW 17 49483060 missense probably damaging 1.00
R2520:Daam2 UTSW 17 49480757 nonsense probably null
R3004:Daam2 UTSW 17 49460654 missense probably damaging 0.98
R3726:Daam2 UTSW 17 49469738 missense probably damaging 1.00
R3854:Daam2 UTSW 17 49458596 missense probably benign
R4833:Daam2 UTSW 17 49490145 missense possibly damaging 0.91
R4878:Daam2 UTSW 17 49460710 missense probably damaging 1.00
R5015:Daam2 UTSW 17 49476522 missense probably damaging 1.00
R5106:Daam2 UTSW 17 49476461 missense probably damaging 1.00
R5184:Daam2 UTSW 17 49494391 missense possibly damaging 0.50
R5419:Daam2 UTSW 17 49480754 missense possibly damaging 0.95
R5529:Daam2 UTSW 17 49459057 missense probably benign
R5974:Daam2 UTSW 17 49464473 missense probably damaging 1.00
R5979:Daam2 UTSW 17 49459204 missense possibly damaging 0.47
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6050:Daam2 UTSW 17 49486502 missense possibly damaging 0.78
R6180:Daam2 UTSW 17 49469666 missense probably damaging 0.99
R6225:Daam2 UTSW 17 49494439 missense probably damaging 0.98
R6385:Daam2 UTSW 17 49463936 missense probably damaging 1.00
R6426:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6427:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6428:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6539:Daam2 UTSW 17 49469711 missense probably damaging 1.00
R7108:Daam2 UTSW 17 49460674 missense probably damaging 1.00
R7487:Daam2 UTSW 17 49486482 missense probably benign 0.03
R7599:Daam2 UTSW 17 49480727 nonsense probably null
R7763:Daam2 UTSW 17 49490022 missense probably benign 0.04
V1662:Daam2 UTSW 17 49464601 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACTGGAGCAGGCTTTTGTATAC -3'
(R):5'- TAGCTCCCTGAGAGGCATAAAGG -3'

Sequencing Primer
(F):5'- GGAGCAGGCTTTTGTATACTATGAAC -3'
(R):5'- ACTGACCTGAGCTTAGGCAG -3'
Posted On2019-05-15