Incidental Mutation 'R7090:Lipn'
ID 550186
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7090 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34067358-34084918 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34071780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 115 (D115E)
Ref Sequence ENSEMBL: ENSMUSP00000025682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect possibly damaging
Transcript: ENSMUST00000025682
AA Change: D115E

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: D115E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126710
AA Change: D115E

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: D115E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Calm3 A T 7: 16,917,079 Y139* probably null Het
Ccdc27 T C 4: 154,028,066 N584S probably benign Het
Cdh24 C G 14: 54,639,507 G13A probably damaging Het
Chd8 T C 14: 52,215,220 K1281E probably damaging Het
Clasp1 G T 1: 118,482,086 G4C probably benign Het
Cul9 G T 17: 46,500,839 P2488T probably damaging Het
Daam2 A G 17: 49,482,945 V428A probably damaging Het
Dcaf8 A G 1: 172,188,968 S441G probably damaging Het
Dchs2 A G 3: 83,348,274 T2426A probably benign Het
Dpys A G 15: 39,826,883 V358A probably damaging Het
Efhd1 A G 1: 87,289,497 D112G probably damaging Het
Exoc1 T C 5: 76,566,953 S120P unknown Het
Fyco1 A G 9: 123,797,719 L1309S probably damaging Het
Gm14403 A G 2: 177,509,321 N111S possibly damaging Het
Gm5901 A G 7: 105,377,348 T108A probably benign Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itgb5 T G 16: 33,885,094 D251E probably damaging Het
Kcnk15 T C 2: 163,858,717 V292A probably benign Het
Kdm2a A T 19: 4,319,141 Y1149N probably damaging Het
Kdm3a T C 6: 71,595,545 T1011A possibly damaging Het
Krt35 A T 11: 100,095,672 probably null Het
Lpin3 T G 2: 160,896,752 L208R probably damaging Het
Ltf C A 9: 111,025,980 Q354K probably benign Het
Marf1 C A 16: 14,111,702 C1680F possibly damaging Het
Mtss1l T A 8: 110,730,024 V242E probably damaging Het
Myo7b T C 18: 31,998,712 Y477C probably damaging Het
Nbn T A 4: 15,981,350 S481T probably benign Het
Ncoa2 A G 1: 13,186,838 Y146H probably damaging Het
Ntng1 A T 3: 109,935,180 C92* probably null Het
Olfr1049 T A 2: 86,255,076 N206Y probably damaging Het
Olfr1077-ps1 T C 2: 86,526,127 I17V probably benign Het
Olfr133 G A 17: 38,149,494 G302D probably benign Het
Olfr286 C T 15: 98,227,202 V150I probably benign Het
Os9 A T 10: 127,099,678 S308T probably benign Het
Otx2 T A 14: 48,658,735 T289S probably benign Het
Palm2 C T 4: 57,648,042 A60V probably benign Het
Pigg A G 5: 108,336,512 T675A possibly damaging Het
Pink1 C T 4: 138,315,601 E461K probably damaging Het
Pip5k1a A G 3: 95,060,498 S543P possibly damaging Het
Prkaa1 A G 15: 5,177,130 T454A probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rab31 C T 17: 65,698,017 V83I possibly damaging Het
Rabggtb G T 3: 153,910,349 D117E probably benign Het
Rbl1 T C 2: 157,152,900 H951R probably benign Het
Sapcd2 A G 2: 25,376,079 S314G probably benign Het
Sept4 T C 11: 87,584,438 L164P probably damaging Het
Shroom1 A G 11: 53,465,933 E541G probably damaging Het
Slc26a7 C A 4: 14,565,460 G208* probably null Het
Smco2 A G 6: 146,871,213 I304M probably damaging Het
Spg7 T C 8: 123,091,752 probably null Het
Spocd1 T C 4: 129,953,898 F552L Het
St6galnac2 T C 11: 116,677,635 D334G probably damaging Het
Sub1 A G 15: 11,986,486 S92P probably benign Het
Syne2 T C 12: 75,942,351 F1829L probably benign Het
Tdrd1 T C 19: 56,851,401 V631A probably benign Het
Tdrd9 T C 12: 111,992,470 S113P probably benign Het
Tgfbrap1 A C 1: 43,071,565 V260G probably damaging Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Urb2 T C 8: 124,030,599 V1015A probably benign Het
Usp5 A G 6: 124,829,394 M1T probably null Het
Utrn T C 10: 12,684,516 D1343G possibly damaging Het
Vmn2r56 T C 7: 12,715,327 Y328C probably damaging Het
Vmn2r99 A T 17: 19,393,710 E564V possibly damaging Het
Wdr63 C A 3: 146,040,827 K881N possibly damaging Het
Zc3h8 T C 2: 128,935,321 T133A possibly damaging Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34079035 missense probably benign 0.06
IGL01320:Lipn APN 19 34084640 missense probably benign 0.07
IGL01827:Lipn APN 19 34069480 missense probably damaging 1.00
IGL02252:Lipn APN 19 34071757 missense probably benign 0.01
IGL02422:Lipn APN 19 34068663 missense probably benign 0.00
R0081:Lipn UTSW 19 34076976 missense probably benign 0.00
R0284:Lipn UTSW 19 34080706 missense possibly damaging 0.87
R0539:Lipn UTSW 19 34084603 unclassified probably benign
R0749:Lipn UTSW 19 34076979 missense probably damaging 1.00
R1170:Lipn UTSW 19 34071758 missense probably benign 0.23
R1528:Lipn UTSW 19 34068670 missense probably damaging 0.96
R1621:Lipn UTSW 19 34068713 missense probably benign
R1675:Lipn UTSW 19 34080710 missense probably damaging 1.00
R1869:Lipn UTSW 19 34080739 missense possibly damaging 0.93
R3236:Lipn UTSW 19 34068738 missense probably benign 0.17
R3237:Lipn UTSW 19 34068738 missense probably benign 0.17
R3832:Lipn UTSW 19 34069533 critical splice donor site probably null
R3876:Lipn UTSW 19 34069428 missense probably benign 0.00
R4084:Lipn UTSW 19 34078940 missense probably benign 0.04
R4595:Lipn UTSW 19 34081350 missense probably damaging 1.00
R5963:Lipn UTSW 19 34081300 missense probably damaging 0.97
R6018:Lipn UTSW 19 34076935 missense probably damaging 1.00
R6797:Lipn UTSW 19 34080760 missense probably benign
R7157:Lipn UTSW 19 34076990 nonsense probably null
R7458:Lipn UTSW 19 34071842 missense probably benign 0.10
R8824:Lipn UTSW 19 34084716 missense probably benign 0.04
R8894:Lipn UTSW 19 34084848 makesense probably null
R8933:Lipn UTSW 19 34069480 missense probably damaging 0.98
R9054:Lipn UTSW 19 34076976 missense possibly damaging 0.56
R9117:Lipn UTSW 19 34068641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGCTATAGTGCGTCCTC -3'
(R):5'- TGGACTGTCTAAGAGGAAAGGTTTG -3'

Sequencing Primer
(F):5'- TCCTCTGGCAGGGGTGATATAAATAC -3'
(R):5'- TTTTCTTTCTGAATTCTACGTCAGG -3'
Posted On 2019-05-15