Incidental Mutation 'R7091:Gulp1'
ID550188
Institutional Source Beutler Lab
Gene Symbol Gulp1
Ensembl Gene ENSMUSG00000056870
Gene NameGULP, engulfment adaptor PTB domain containing 1
Synonyms3110030A04Rik, GULP, CED-6, Ced6, 5730529O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location44551511-44796838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44766134 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 128 (F128I)
Ref Sequence ENSEMBL: ENSMUSP00000125506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074525] [ENSMUST00000159555] [ENSMUST00000160854] [ENSMUST00000162600]
Predicted Effect probably damaging
Transcript: ENSMUST00000074525
AA Change: F128I

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074115
Gene: ENSMUSG00000056870
AA Change: F128I

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159555
Predicted Effect probably damaging
Transcript: ENSMUST00000160854
AA Change: F128I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125506
Gene: ENSMUSG00000056870
AA Change: F128I

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 159 202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162600
AA Change: F128I

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124756
Gene: ENSMUSG00000056870
AA Change: F128I

DomainStartEndE-ValueType
PTB 22 158 1.11e-38 SMART
coiled coil region 178 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Gulp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Gulp1 APN 1 44744548 splice site probably benign
IGL02439:Gulp1 APN 1 44781004 missense probably damaging 0.96
IGL03410:Gulp1 APN 1 44708617 missense probably damaging 0.97
guzzle UTSW 1 44708669 nonsense probably null
R1746:Gulp1 UTSW 1 44754353 missense possibly damaging 0.81
R1990:Gulp1 UTSW 1 44766114 missense possibly damaging 0.92
R4166:Gulp1 UTSW 1 44708669 nonsense probably null
R4895:Gulp1 UTSW 1 44788597 missense probably benign
R5208:Gulp1 UTSW 1 44781039 missense probably benign 0.00
R5244:Gulp1 UTSW 1 44788453 missense probably damaging 1.00
R5533:Gulp1 UTSW 1 44773281 missense probably damaging 1.00
R5911:Gulp1 UTSW 1 44754374 missense possibly damaging 0.55
R6164:Gulp1 UTSW 1 44754351 missense probably damaging 0.98
R6503:Gulp1 UTSW 1 44773380 missense probably damaging 1.00
R7026:Gulp1 UTSW 1 44781085 missense possibly damaging 0.65
R7207:Gulp1 UTSW 1 44766132 missense possibly damaging 0.61
Z1176:Gulp1 UTSW 1 44788479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATGTGCAATGATAAGATC -3'
(R):5'- CCTGAAGCCTGTTCTCATGACAG -3'

Sequencing Primer
(F):5'- GTGCAATGATAAGATCAAGGTTTGAC -3'
(R):5'- GCCTGTTCTCATGACAGGATGAATC -3'
Posted On2019-05-15