Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Olfr142'

550193

Institutional Source

Beutler Lab

Gene Symbol

Olfr142

Ensembl Gene

ENSMUSG00000075063

Gene Name

olfactory receptor 142

Synonyms

GA_x6K02T2Q125-51607674-51606757, K20, MOR227-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90250130-90257592 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 90252463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 175 (Y175C)

Ref Sequence

ENSEMBL: ENSMUSP00000150216 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]

AlphaFold

Q60881

Predicted Effect

probably damaging
Transcript: ENSMUST00000099752
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: Y175C

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	4.3e-53	PFAM
Pfam:7TM_GPCR_Srsx	33	300	3e-6	PFAM
Pfam:7tm_1	39	285	5.8e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213968
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Olfr142

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Olfr142	APN	2	90252609	missense	probably damaging	1.00
IGL01623:Olfr142	APN	2	90252609	missense	probably damaging	1.00
IGL01810:Olfr142	APN	2	90252132	nonsense	probably null
IGL01918:Olfr142	APN	2	90252331	missense	probably damaging	1.00
IGL02619:Olfr142	APN	2	90252505	missense	probably damaging	0.97
IGL02732:Olfr142	APN	2	90252308	missense	probably damaging	1.00
IGL02738:Olfr142	APN	2	90252355	missense	possibly damaging	0.82
IGL02795:Olfr142	APN	2	90252562	missense	probably damaging	1.00
IGL02830:Olfr142	APN	2	90252781	missense	probably damaging	1.00
R0601:Olfr142	UTSW	2	90252934	missense	probably benign	0.05
R2004:Olfr142	UTSW	2	90252692	missense	probably benign	0.04
R2136:Olfr142	UTSW	2	90252253	missense	probably damaging	0.98
R2377:Olfr142	UTSW	2	90252911	missense	probably damaging	1.00
R3615:Olfr142	UTSW	2	90252409	missense	possibly damaging	0.94
R3616:Olfr142	UTSW	2	90252409	missense	possibly damaging	0.94
R3777:Olfr142	UTSW	2	90252625	missense	probably damaging	1.00
R4763:Olfr142	UTSW	2	90252463	missense	probably damaging	1.00
R4765:Olfr142	UTSW	2	90252463	missense	probably damaging	1.00
R5421:Olfr142	UTSW	2	90252745	missense	probably benign	0.01
R5426:Olfr142	UTSW	2	90252611	nonsense	probably null
R6063:Olfr142	UTSW	2	90252427	missense	probably benign	0.40
R6717:Olfr142	UTSW	2	90252524	missense	probably benign	0.00
R6931:Olfr142	UTSW	2	90252777	nonsense	probably null
R6936:Olfr142	UTSW	2	90252334	missense	probably benign	0.17
R7013:Olfr142	UTSW	2	90252097	missense	possibly damaging	0.87
R7247:Olfr142	UTSW	2	90252821	missense	probably damaging	1.00
R8169:Olfr142	UTSW	2	90252098	nonsense	probably null
R8345:Olfr142	UTSW	2	90252217	missense	possibly damaging	0.50
R9222:Olfr142	UTSW	2	90252476	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACAGGATGACCACTGTGATG -3'
(R):5'- GTGATGGCCTATGACCGCTATG -3'

Sequencing Primer
(F):5'- CCACTGTGATGTGAGAGGC -3'
(R):5'- GCTATGTGGCCATCTGCAAAC -3'

Posted On

2019-05-15