Incidental Mutation 'R7091:Ivl'
ID 550198
Institutional Source Beutler Lab
Gene Symbol Ivl
Ensembl Gene ENSMUSG00000049128
Gene Name involucrin
Synonyms 1110019C06Rik
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 92478209-92481042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92479549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Ref Sequence ENSEMBL: ENSMUSP00000059780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053107]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000053107
AA Change: D172G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059780
Gene: ENSMUSG00000049128
AA Change: D172G

DomainStartEndE-ValueType
Pfam:Involucrin_N 1 67 2e-32 PFAM
Pfam:Involucrin2 94 134 1.3e-7 PFAM
Pfam:Involucrin2 173 211 1.9e-13 PFAM
Pfam:Involucrin2 210 249 4.1e-12 PFAM
Pfam:Involucrin2 239 278 2.9e-13 PFAM
Pfam:Involucrin2 268 306 4.1e-10 PFAM
Pfam:Involucrin2 311 351 4.6e-14 PFAM
Pfam:Involucrin2 343 376 1.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Ivl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Ivl APN 3 92,479,819 (GRCm39) missense possibly damaging 0.68
IGL01656:Ivl APN 3 92,478,962 (GRCm39) nonsense probably null
IGL01820:Ivl APN 3 92,478,940 (GRCm39) missense possibly damaging 0.95
IGL03012:Ivl APN 3 92,479,733 (GRCm39) missense probably benign 0.01
PIT4142001:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
PIT4151001:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
PIT4458001:Ivl UTSW 3 92,479,608 (GRCm39) small insertion probably benign
R0256:Ivl UTSW 3 92,479,150 (GRCm39) missense probably damaging 1.00
R0276:Ivl UTSW 3 92,478,821 (GRCm39) missense unknown
R1800:Ivl UTSW 3 92,479,891 (GRCm39) missense unknown
R1940:Ivl UTSW 3 92,480,056 (GRCm39) missense probably benign 0.00
R1950:Ivl UTSW 3 92,479,420 (GRCm39) missense possibly damaging 0.85
R2887:Ivl UTSW 3 92,478,699 (GRCm39) missense unknown
R4457:Ivl UTSW 3 92,479,673 (GRCm39) missense probably benign 0.03
R4561:Ivl UTSW 3 92,479,262 (GRCm39) small insertion probably benign
R4562:Ivl UTSW 3 92,479,262 (GRCm39) small insertion probably benign
R4698:Ivl UTSW 3 92,478,698 (GRCm39) missense unknown
R4708:Ivl UTSW 3 92,479,057 (GRCm39) missense probably damaging 1.00
R4885:Ivl UTSW 3 92,479,718 (GRCm39) missense probably benign 0.03
R6354:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6355:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6356:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6582:Ivl UTSW 3 92,479,217 (GRCm39) small deletion probably benign
R6723:Ivl UTSW 3 92,478,694 (GRCm39) missense unknown
R7146:Ivl UTSW 3 92,479,538 (GRCm39) missense probably damaging 0.97
R7755:Ivl UTSW 3 92,479,317 (GRCm39) missense probably damaging 0.98
R7841:Ivl UTSW 3 92,479,699 (GRCm39) missense possibly damaging 0.52
R8048:Ivl UTSW 3 92,479,231 (GRCm39) missense probably damaging 1.00
R8171:Ivl UTSW 3 92,479,085 (GRCm39) missense probably damaging 1.00
R8363:Ivl UTSW 3 92,479,525 (GRCm39) missense possibly damaging 0.71
R8434:Ivl UTSW 3 92,479,943 (GRCm39) missense probably benign 0.01
R8504:Ivl UTSW 3 92,480,078 (GRCm39) start gained probably benign
R8677:Ivl UTSW 3 92,479,986 (GRCm39) missense probably benign 0.00
R8688:Ivl UTSW 3 92,479,608 (GRCm39) small deletion probably benign
R8691:Ivl UTSW 3 92,478,823 (GRCm39) missense unknown
RF013:Ivl UTSW 3 92,479,650 (GRCm39) small deletion probably benign
RF031:Ivl UTSW 3 92,479,625 (GRCm39) frame shift probably null
RF036:Ivl UTSW 3 92,479,648 (GRCm39) frame shift probably null
RF038:Ivl UTSW 3 92,479,607 (GRCm39) small deletion probably benign
RF055:Ivl UTSW 3 92,479,607 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTTGCAGTTCTGGTTCATG -3'
(R):5'- CTGTGCCTGGAACAACAAC -3'

Sequencing Primer
(F):5'- TGTCCCAGGTGTAGCTCC -3'
(R):5'- GTGCCTGGAACAACAACAGCAG -3'
Posted On 2019-05-15