Incidental Mutation 'R7091:Baat'
ID550201
Institutional Source Beutler Lab
Gene Symbol Baat
Ensembl Gene ENSMUSG00000039653
Gene Namebile acid-Coenzyme A: amino acid N-acyltransferase
Synonymstaurine N-acyltransferase, BAT
MMRRC Submission
Accession Numbers

Genbank: NM_007519; MGI: 106642

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49489422-49506557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49499692 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 205 (K205E)
Ref Sequence ENSEMBL: ENSMUSP00000041983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043056] [ENSMUST00000166036]
Predicted Effect probably benign
Transcript: ENSMUST00000043056
AA Change: K205E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000041983
Gene: ENSMUSG00000039653
AA Change: K205E

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 13 145 1.7e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 8.1e-77 PFAM
Pfam:DLH 285 412 5.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166036
AA Change: K205E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129603
Gene: ENSMUSG00000039653
AA Change: K205E

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 144 5.1e-45 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:BAAT_C 206 414 1.2e-77 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Baat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Baat APN 4 49490352 missense probably damaging 1.00
IGL01124:Baat APN 4 49490391 missense possibly damaging 0.82
IGL01327:Baat APN 4 49490338 missense probably damaging 1.00
IGL02394:Baat APN 4 49489812 unclassified probably benign
IGL03267:Baat APN 4 49490050 missense probably benign 0.00
R0085:Baat UTSW 4 49490425 splice site probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1467:Baat UTSW 4 49503101 missense probably benign
R1720:Baat UTSW 4 49490231 missense probably benign
R2309:Baat UTSW 4 49499718 missense probably damaging 1.00
R2992:Baat UTSW 4 49499675 nonsense probably null
R4383:Baat UTSW 4 49499731 missense probably damaging 1.00
R4602:Baat UTSW 4 49502727 missense probably damaging 1.00
R5190:Baat UTSW 4 49499652 missense probably damaging 1.00
R5259:Baat UTSW 4 49490070 missense probably benign 0.08
R5456:Baat UTSW 4 49502949 missense possibly damaging 0.91
R5988:Baat UTSW 4 49502871 missense probably damaging 1.00
R6265:Baat UTSW 4 49502836 missense possibly damaging 0.94
R7209:Baat UTSW 4 49503065 missense probably damaging 1.00
R7295:Baat UTSW 4 49490275 missense probably damaging 1.00
R7325:Baat UTSW 4 49490213 missense probably benign 0.07
R7805:Baat UTSW 4 49490327 missense probably benign 0.00
R7867:Baat UTSW 4 49502925 missense probably benign 0.44
R7950:Baat UTSW 4 49502925 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTTGGGAATTGGGCTGCAA -3'
(R):5'- CACCTATCCTCCTGAGACCTCAC -3'

Sequencing Primer
(F):5'- ATTGGGCTGCAAACTGTAAGTC -3'
(R):5'- TTTCTTCTCCAGGGACACGGAAG -3'
Posted On2019-05-15