Incidental Mutation 'R7091:Hcrtr1'
ID 550202
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 130130914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 393 (L393W)
Ref Sequence ENSEMBL: ENSMUSP00000030562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000030563] [ENSMUST00000118199] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect probably damaging
Transcript: ENSMUST00000030562
AA Change: L393W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: L393W

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030563
SMART Domains Protein: ENSMUSP00000030563
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118199
SMART Domains Protein: ENSMUSP00000112638
Gene: ENSMUSG00000028779

DomainStartEndE-ValueType
low complexity region 11 101 N/A INTRINSIC
EFh 109 137 2.5e-2 SMART
EFh 146 174 1.23e1 SMART
EFh 176 204 4.42e-3 SMART
Blast:EFh 243 273 3e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119423
AA Change: L393W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: L393W

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120154
AA Change: L393W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: L393W

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164887
AA Change: L393W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: L393W

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R3028:Hcrtr1 UTSW 4 130135811 missense probably benign 0.31
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R5636:Hcrtr1 UTSW 4 130130945 missense possibly damaging 0.59
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7042:Hcrtr1 UTSW 4 130130860 unclassified probably benign
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R7612:Hcrtr1 UTSW 4 130135685 missense possibly damaging 0.61
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
R9410:Hcrtr1 UTSW 4 130135721 missense probably damaging 0.98
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGGGACACAACCTCAGAG -3'
(R):5'- CTCTAGCTAGAGTTGTGCAGG -3'

Sequencing Primer
(F):5'- CCTCAGAGAGGGGATGACTC -3'
(R):5'- CAGGTGTTCCTTGAGGTCAACC -3'
Posted On 2019-05-15