Incidental Mutation 'R7091:Vmn2r27'
ID 550212
Institutional Source Beutler Lab
Gene Symbol Vmn2r27
Ensembl Gene ENSMUSG00000072778
Gene Name vomeronasal 2, receptor27
Synonyms EG232367
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124191596-124231784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 124223945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 351 (Q351P)
Ref Sequence ENSEMBL: ENSMUSP00000098528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100968]
AlphaFold D3YUK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000100968
AA Change: Q351P

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: Q351P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 81 475 1.1e-27 PFAM
Pfam:NCD3G 519 570 1.3e-18 PFAM
Pfam:7tm_3 603 838 2.6e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Vmn2r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Vmn2r27 APN 6 124192411 missense possibly damaging 0.86
IGL01388:Vmn2r27 APN 6 124223832 missense possibly damaging 0.55
IGL01923:Vmn2r27 APN 6 124200525 missense probably benign 0.20
IGL01954:Vmn2r27 APN 6 124192248 missense probably damaging 1.00
IGL02105:Vmn2r27 APN 6 124197349 splice site probably benign
IGL02586:Vmn2r27 APN 6 124224475 nonsense probably null
IGL03130:Vmn2r27 APN 6 124192317 missense possibly damaging 0.82
IGL03330:Vmn2r27 APN 6 124230180 nonsense probably null
R0124:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0384:Vmn2r27 UTSW 6 124223912 missense probably benign 0.01
R0582:Vmn2r27 UTSW 6 124224290 missense probably benign 0.02
R0733:Vmn2r27 UTSW 6 124192188 missense probably benign 0.18
R0738:Vmn2r27 UTSW 6 124223702 missense possibly damaging 0.48
R0835:Vmn2r27 UTSW 6 124200624 missense probably damaging 0.99
R1183:Vmn2r27 UTSW 6 124200532 missense probably benign
R1401:Vmn2r27 UTSW 6 124191632 nonsense probably null
R1484:Vmn2r27 UTSW 6 124200515 missense probably damaging 0.96
R1536:Vmn2r27 UTSW 6 124200690 missense probably damaging 1.00
R1539:Vmn2r27 UTSW 6 124191771 missense probably damaging 1.00
R1565:Vmn2r27 UTSW 6 124231634 missense probably benign
R1595:Vmn2r27 UTSW 6 124231615 missense probably benign 0.00
R1614:Vmn2r27 UTSW 6 124223934 missense probably benign 0.01
R1742:Vmn2r27 UTSW 6 124200677 missense possibly damaging 0.48
R1816:Vmn2r27 UTSW 6 124230371 nonsense probably null
R1822:Vmn2r27 UTSW 6 124231634 missense probably benign
R1824:Vmn2r27 UTSW 6 124231634 missense probably benign
R1870:Vmn2r27 UTSW 6 124224211 missense probably benign 0.11
R1942:Vmn2r27 UTSW 6 124223763 missense probably damaging 1.00
R1962:Vmn2r27 UTSW 6 124223834 missense possibly damaging 0.70
R2069:Vmn2r27 UTSW 6 124224483 missense probably damaging 1.00
R2075:Vmn2r27 UTSW 6 124200551 missense possibly damaging 0.85
R2379:Vmn2r27 UTSW 6 124224383 missense possibly damaging 0.89
R3748:Vmn2r27 UTSW 6 124230392 missense probably benign 0.35
R4384:Vmn2r27 UTSW 6 124224156 missense probably benign 0.05
R4392:Vmn2r27 UTSW 6 124230176 missense probably benign 0.01
R4758:Vmn2r27 UTSW 6 124231637 missense possibly damaging 0.87
R5018:Vmn2r27 UTSW 6 124224182 missense probably benign 0.02
R5235:Vmn2r27 UTSW 6 124192054 missense probably damaging 0.99
R5718:Vmn2r27 UTSW 6 124192144 missense possibly damaging 0.66
R5859:Vmn2r27 UTSW 6 124200688 missense probably damaging 1.00
R5958:Vmn2r27 UTSW 6 124231727 missense probably benign 0.00
R6044:Vmn2r27 UTSW 6 124231772 missense probably benign
R6086:Vmn2r27 UTSW 6 124191999 missense probably damaging 1.00
R6396:Vmn2r27 UTSW 6 124224166 nonsense probably null
R6546:Vmn2r27 UTSW 6 124192410 missense possibly damaging 0.49
R6746:Vmn2r27 UTSW 6 124200593 missense possibly damaging 0.47
R6976:Vmn2r27 UTSW 6 124224353 nonsense probably null
R7145:Vmn2r27 UTSW 6 124191752 missense probably benign
R7176:Vmn2r27 UTSW 6 124192036 missense probably benign 0.01
R7382:Vmn2r27 UTSW 6 124197317 missense probably damaging 1.00
R7482:Vmn2r27 UTSW 6 124224261 missense probably damaging 1.00
R7853:Vmn2r27 UTSW 6 124192021 missense probably damaging 1.00
R7859:Vmn2r27 UTSW 6 124224242 missense probably benign 0.00
R7959:Vmn2r27 UTSW 6 124192081 missense probably benign
R8266:Vmn2r27 UTSW 6 124191978 missense probably benign 0.00
R8353:Vmn2r27 UTSW 6 124192445 missense probably damaging 0.99
R8394:Vmn2r27 UTSW 6 124191817 missense possibly damaging 0.71
R8463:Vmn2r27 UTSW 6 124192209 missense probably damaging 1.00
R8477:Vmn2r27 UTSW 6 124224241 missense probably benign 0.11
R8705:Vmn2r27 UTSW 6 124230229 missense probably damaging 1.00
R8752:Vmn2r27 UTSW 6 124224059 missense probably benign 0.00
R9109:Vmn2r27 UTSW 6 124197265 missense possibly damaging 0.95
R9140:Vmn2r27 UTSW 6 124192248 missense probably damaging 1.00
R9157:Vmn2r27 UTSW 6 124224285 missense probably benign 0.09
R9431:Vmn2r27 UTSW 6 124191897 missense probably damaging 1.00
R9477:Vmn2r27 UTSW 6 124191951 missense probably damaging 0.99
R9758:Vmn2r27 UTSW 6 124191678 missense possibly damaging 0.89
Z1177:Vmn2r27 UTSW 6 124191901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCTGACTGACAGCTC -3'
(R):5'- CGTTCTTGCCTTTTAATGGCAATG -3'

Sequencing Primer
(F):5'- TCTGACTGACAGCTCCACATGG -3'
(R):5'- GCCTTTTAATGGCAATGTCTTGATC -3'
Posted On 2019-05-15