Incidental Mutation 'R7091:Zfp747l1'
ID 550213
Institutional Source Beutler Lab
Gene Symbol Zfp747l1
Ensembl Gene ENSMUSG00000030823
Gene Name zinc finger protein 747 like 1
Synonyms 9130019O22Rik
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126981432-126986338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 126983534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 523 (A523S)
Ref Sequence ENSEMBL: ENSMUSP00000038195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000164345]
AlphaFold G3X941
Predicted Effect possibly damaging
Transcript: ENSMUST00000049052
AA Change: A523S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823
AA Change: A523S

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Zfp747l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zfp747l1 APN 7 126,985,716 (GRCm39) unclassified probably benign
IGL03102:Zfp747l1 APN 7 126,983,951 (GRCm39) missense probably benign 0.01
IGL03264:Zfp747l1 APN 7 126,984,811 (GRCm39) unclassified probably benign
R1653:Zfp747l1 UTSW 7 126,983,652 (GRCm39) missense possibly damaging 0.71
R1692:Zfp747l1 UTSW 7 126,983,652 (GRCm39) missense possibly damaging 0.71
R2042:Zfp747l1 UTSW 7 126,984,641 (GRCm39) missense possibly damaging 0.93
R2132:Zfp747l1 UTSW 7 126,986,107 (GRCm39) missense probably benign
R3768:Zfp747l1 UTSW 7 126,984,035 (GRCm39) unclassified probably benign
R3769:Zfp747l1 UTSW 7 126,984,035 (GRCm39) unclassified probably benign
R3770:Zfp747l1 UTSW 7 126,984,035 (GRCm39) unclassified probably benign
R4459:Zfp747l1 UTSW 7 126,983,917 (GRCm39) missense probably damaging 0.98
R4461:Zfp747l1 UTSW 7 126,983,917 (GRCm39) missense probably damaging 0.98
R4839:Zfp747l1 UTSW 7 126,984,179 (GRCm39) missense probably benign 0.32
R4903:Zfp747l1 UTSW 7 126,984,578 (GRCm39) missense probably benign 0.02
R5231:Zfp747l1 UTSW 7 126,984,586 (GRCm39) missense probably damaging 0.98
R5324:Zfp747l1 UTSW 7 126,984,079 (GRCm39) unclassified probably benign
R5735:Zfp747l1 UTSW 7 126,984,579 (GRCm39) missense possibly damaging 0.60
R5808:Zfp747l1 UTSW 7 126,984,085 (GRCm39) unclassified probably benign
R6429:Zfp747l1 UTSW 7 126,984,214 (GRCm39) unclassified probably benign
R6571:Zfp747l1 UTSW 7 126,984,310 (GRCm39) unclassified probably benign
R6655:Zfp747l1 UTSW 7 126,983,512 (GRCm39) missense possibly damaging 0.96
R6806:Zfp747l1 UTSW 7 126,985,766 (GRCm39) unclassified probably benign
R6962:Zfp747l1 UTSW 7 126,983,487 (GRCm39) missense possibly damaging 0.70
R7204:Zfp747l1 UTSW 7 126,983,518 (GRCm39) missense possibly damaging 0.92
R7218:Zfp747l1 UTSW 7 126,983,852 (GRCm39) missense probably benign 0.32
R7570:Zfp747l1 UTSW 7 126,984,455 (GRCm39) missense probably benign 0.00
R7604:Zfp747l1 UTSW 7 126,985,707 (GRCm39) missense unknown
R7661:Zfp747l1 UTSW 7 126,984,135 (GRCm39) nonsense probably null
R7893:Zfp747l1 UTSW 7 126,985,716 (GRCm39) unclassified probably benign
R8323:Zfp747l1 UTSW 7 126,983,621 (GRCm39) missense possibly damaging 0.71
R9172:Zfp747l1 UTSW 7 126,984,626 (GRCm39) missense probably benign 0.38
R9204:Zfp747l1 UTSW 7 126,984,332 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AACGTCTGTGACTTCTGGAG -3'
(R):5'- CGCATCCATACAGGTGAAAAGC -3'

Sequencing Primer
(F):5'- CTGGAGGATGCTATAGGTCATTCTC -3'
(R):5'- GGTGAAAAGCCTTATTCATGCCCTG -3'
Posted On 2019-05-15