Incidental Mutation 'R0615:Nr3c2'
ID55022
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77185889 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 710 (T710P)
Ref Sequence ENSEMBL: ENSMUSP00000105539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000148106]
Predicted Effect probably benign
Transcript: ENSMUST00000034031
AA Change: T714P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: T714P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109911
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109912
AA Change: T710P

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: T710P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109913
AA Change: T710P

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: T710P

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126697
Predicted Effect probably benign
Transcript: ENSMUST00000148106
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GGAGAGAGCCTTCCTTGATTGCAAC -3'
(R):5'- ACTTGGATCATCTGCTTGCCCG -3'

Sequencing Primer
(F):5'- GAAGTCAGTTGTCCCCATGC -3'
(R):5'- TTGGAATTGTCGTAGCCTGC -3'
Posted On2013-07-11