Incidental Mutation 'R7091:Zfp879'
ID 550223
Institutional Source Beutler Lab
Gene Symbol Zfp879
Ensembl Gene ENSMUSG00000044296
Gene Name zinc finger protein 879
Synonyms 9630041N07Rik
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 50722858-50732379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50724222 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 278 (H278L)
Ref Sequence ENSEMBL: ENSMUSP00000061782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049625] [ENSMUST00000109133] [ENSMUST00000109134]
AlphaFold Q8BI99
Predicted Effect probably damaging
Transcript: ENSMUST00000049625
AA Change: H278L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061782
Gene: ENSMUSG00000044296
AA Change: H278L

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109133
AA Change: H205L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104761
Gene: ENSMUSG00000044296
AA Change: H205L

DomainStartEndE-ValueType
ZnF_C2H2 131 153 1.92e-2 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 1.16e-1 SMART
ZnF_C2H2 215 237 4.54e-4 SMART
ZnF_C2H2 243 265 8.34e-3 SMART
ZnF_C2H2 271 293 4.87e-4 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.84e-4 SMART
ZnF_C2H2 355 377 2.57e-3 SMART
ZnF_C2H2 383 405 1.47e-3 SMART
ZnF_C2H2 411 433 3.21e-4 SMART
ZnF_C2H2 439 461 1.5e-4 SMART
ZnF_C2H2 467 489 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109134
AA Change: H278L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104762
Gene: ENSMUSG00000044296
AA Change: H278L

DomainStartEndE-ValueType
KRAB 14 74 1.54e-33 SMART
ZnF_C2H2 204 226 1.92e-2 SMART
ZnF_C2H2 232 254 1.38e-3 SMART
ZnF_C2H2 260 282 1.16e-1 SMART
ZnF_C2H2 288 310 4.54e-4 SMART
ZnF_C2H2 316 338 8.34e-3 SMART
ZnF_C2H2 344 366 4.87e-4 SMART
ZnF_C2H2 372 394 8.47e-4 SMART
ZnF_C2H2 400 422 1.84e-4 SMART
ZnF_C2H2 428 450 2.57e-3 SMART
ZnF_C2H2 456 478 1.47e-3 SMART
ZnF_C2H2 484 506 3.21e-4 SMART
ZnF_C2H2 512 534 1.5e-4 SMART
ZnF_C2H2 540 562 5.21e-4 SMART
Meta Mutation Damage Score 0.7693 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Other mutations in Zfp879
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Zfp879 APN 11 50,729,281 (GRCm39) missense probably damaging 1.00
IGL02175:Zfp879 APN 11 50,728,743 (GRCm39) missense probably benign 0.13
IGL02259:Zfp879 APN 11 50,729,255 (GRCm39) missense probably benign 0.00
Bazooka UTSW 11 50,729,302 (GRCm39) missense probably damaging 0.98
joe UTSW 11 50,724,222 (GRCm39) missense probably damaging 0.99
R0131:Zfp879 UTSW 11 50,724,426 (GRCm39) missense probably damaging 1.00
R1430:Zfp879 UTSW 11 50,724,784 (GRCm39) missense probably benign 0.00
R1576:Zfp879 UTSW 11 50,724,376 (GRCm39) missense probably benign 0.41
R1616:Zfp879 UTSW 11 50,723,473 (GRCm39) missense probably benign 0.06
R1701:Zfp879 UTSW 11 50,724,060 (GRCm39) missense possibly damaging 0.77
R1965:Zfp879 UTSW 11 50,724,355 (GRCm39) missense probably damaging 1.00
R2057:Zfp879 UTSW 11 50,723,428 (GRCm39) missense probably benign
R2058:Zfp879 UTSW 11 50,723,428 (GRCm39) missense probably benign
R2219:Zfp879 UTSW 11 50,724,094 (GRCm39) missense probably damaging 1.00
R3110:Zfp879 UTSW 11 50,723,989 (GRCm39) missense possibly damaging 0.87
R3112:Zfp879 UTSW 11 50,723,989 (GRCm39) missense possibly damaging 0.87
R4658:Zfp879 UTSW 11 50,724,024 (GRCm39) missense probably damaging 1.00
R4845:Zfp879 UTSW 11 50,724,672 (GRCm39) missense probably damaging 1.00
R4998:Zfp879 UTSW 11 50,728,796 (GRCm39) missense probably damaging 1.00
R6362:Zfp879 UTSW 11 50,729,302 (GRCm39) missense probably damaging 0.98
R6930:Zfp879 UTSW 11 50,723,839 (GRCm39) missense probably damaging 1.00
R7186:Zfp879 UTSW 11 50,724,621 (GRCm39) missense probably benign 0.06
R7218:Zfp879 UTSW 11 50,723,508 (GRCm39) missense possibly damaging 0.61
R8138:Zfp879 UTSW 11 50,724,275 (GRCm39) nonsense probably null
R8445:Zfp879 UTSW 11 50,724,213 (GRCm39) missense probably damaging 0.98
R8523:Zfp879 UTSW 11 50,728,757 (GRCm39) missense probably benign
R8725:Zfp879 UTSW 11 50,729,321 (GRCm39) missense probably damaging 0.98
R8790:Zfp879 UTSW 11 50,723,429 (GRCm39) nonsense probably null
R8882:Zfp879 UTSW 11 50,724,763 (GRCm39) nonsense probably null
R9229:Zfp879 UTSW 11 50,723,886 (GRCm39) missense probably damaging 1.00
X0066:Zfp879 UTSW 11 50,723,914 (GRCm39) missense possibly damaging 0.89
Z1177:Zfp879 UTSW 11 50,724,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGCCGTGATATTGATG -3'
(R):5'- GGAAAGTCTTCTTCCACAGTTCCTC -3'

Sequencing Primer
(F):5'- ACACTGGCTGCATTCATATGG -3'
(R):5'- TCCCTGAGCAAGCATCAGAGG -3'
Posted On 2019-05-15