Incidental Mutation 'R7091:Spag5'
ID 550225
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Name sperm associated antigen 5
Synonyms s17, Astrin, Mastrin, MAP126, Deepest, D11Bhm180e, S17
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78192412-78213283 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 78204017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045026]
AlphaFold Q7TME2
Predicted Effect probably null
Transcript: ENSMUST00000045026
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78,195,443 (GRCm39) missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78,195,085 (GRCm39) missense probably benign 0.06
IGL02066:Spag5 APN 11 78,195,358 (GRCm39) missense probably benign
IGL02140:Spag5 APN 11 78,206,459 (GRCm39) missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78,210,860 (GRCm39) missense probably damaging 1.00
IGL02452:Spag5 APN 11 78,195,449 (GRCm39) missense probably benign 0.08
IGL02658:Spag5 APN 11 78,212,157 (GRCm39) nonsense probably null
boyardee UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
Franco UTSW 11 78,205,008 (GRCm39) nonsense probably null
spaghetto UTSW 11 78,204,205 (GRCm39) nonsense probably null
IGL02991:Spag5 UTSW 11 78,205,077 (GRCm39) missense probably damaging 0.99
R0477:Spag5 UTSW 11 78,205,024 (GRCm39) missense probably damaging 1.00
R0512:Spag5 UTSW 11 78,210,412 (GRCm39) unclassified probably benign
R0535:Spag5 UTSW 11 78,195,554 (GRCm39) missense probably benign 0.00
R0557:Spag5 UTSW 11 78,205,037 (GRCm39) missense probably damaging 0.99
R0584:Spag5 UTSW 11 78,194,921 (GRCm39) missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78,204,222 (GRCm39) missense probably damaging 1.00
R0723:Spag5 UTSW 11 78,210,410 (GRCm39) unclassified probably benign
R1413:Spag5 UTSW 11 78,196,143 (GRCm39) nonsense probably null
R1680:Spag5 UTSW 11 78,211,442 (GRCm39) missense probably damaging 1.00
R1687:Spag5 UTSW 11 78,195,755 (GRCm39) missense probably benign 0.32
R1696:Spag5 UTSW 11 78,212,152 (GRCm39) missense probably damaging 1.00
R1831:Spag5 UTSW 11 78,205,082 (GRCm39) missense probably benign 0.08
R1866:Spag5 UTSW 11 78,195,281 (GRCm39) missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78,195,002 (GRCm39) missense probably benign 0.01
R4004:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4005:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4222:Spag5 UTSW 11 78,195,337 (GRCm39) missense probably damaging 1.00
R4750:Spag5 UTSW 11 78,210,878 (GRCm39) missense probably benign 0.00
R4771:Spag5 UTSW 11 78,195,592 (GRCm39) missense probably damaging 1.00
R4928:Spag5 UTSW 11 78,205,199 (GRCm39) missense probably damaging 0.97
R5360:Spag5 UTSW 11 78,205,588 (GRCm39) missense probably damaging 0.99
R5366:Spag5 UTSW 11 78,211,152 (GRCm39) splice site probably null
R5618:Spag5 UTSW 11 78,194,906 (GRCm39) missense probably benign 0.00
R5668:Spag5 UTSW 11 78,195,542 (GRCm39) missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78,194,972 (GRCm39) missense probably benign 0.25
R5859:Spag5 UTSW 11 78,204,360 (GRCm39) missense probably benign 0.38
R6564:Spag5 UTSW 11 78,206,401 (GRCm39) missense probably damaging 1.00
R6571:Spag5 UTSW 11 78,212,095 (GRCm39) missense probably damaging 1.00
R6573:Spag5 UTSW 11 78,205,008 (GRCm39) nonsense probably null
R7074:Spag5 UTSW 11 78,195,868 (GRCm39) critical splice donor site probably null
R7332:Spag5 UTSW 11 78,204,205 (GRCm39) nonsense probably null
R8073:Spag5 UTSW 11 78,192,803 (GRCm39) missense probably benign 0.22
R8709:Spag5 UTSW 11 78,192,738 (GRCm39) missense probably benign
R8723:Spag5 UTSW 11 78,212,215 (GRCm39) missense probably damaging 1.00
R8976:Spag5 UTSW 11 78,195,413 (GRCm39) missense probably benign 0.01
R9053:Spag5 UTSW 11 78,212,575 (GRCm39) missense probably benign 0.14
R9142:Spag5 UTSW 11 78,192,823 (GRCm39) missense possibly damaging 0.56
Z1176:Spag5 UTSW 11 78,205,808 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGTTGTGAGCTAACTTTTCCATC -3'
(R):5'- AGCAAGGACAACAGGTCTCC -3'

Sequencing Primer
(F):5'- CTCGTATGAACAGTTCTTGTAGC -3'
(R):5'- CAGAGACTAGACCCCATGATTGCTG -3'
Posted On 2019-05-15