Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Spag5'

550225

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 78313191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

probably null
Transcript: ENSMUST00000045026

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Meta Mutation Damage Score

0.9591

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGTTGTGAGCTAACTTTTCCATC -3'
(R):5'- AGCAAGGACAACAGGTCTCC -3'

Sequencing Primer
(F):5'- CTCGTATGAACAGTTCTTGTAGC -3'
(R):5'- CAGAGACTAGACCCCATGATTGCTG -3'

Posted On

2019-05-15