Incidental Mutation 'R7091:Spag5'
ID 550225
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Name sperm associated antigen 5
Synonyms D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78301529-78322457 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 78313191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045026]
AlphaFold Q7TME2
Predicted Effect probably null
Transcript: ENSMUST00000045026
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78304617 missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78304259 missense probably benign 0.06
IGL02066:Spag5 APN 11 78304532 missense probably benign
IGL02140:Spag5 APN 11 78315633 missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78320034 missense probably damaging 1.00
IGL02452:Spag5 APN 11 78304623 missense probably benign 0.08
IGL02658:Spag5 APN 11 78321331 nonsense probably null
boyardee UTSW 11 78313191 critical splice donor site probably null
Franco UTSW 11 78314182 nonsense probably null
spaghetto UTSW 11 78313379 nonsense probably null
IGL02991:Spag5 UTSW 11 78314251 missense probably damaging 0.99
R0477:Spag5 UTSW 11 78314198 missense probably damaging 1.00
R0512:Spag5 UTSW 11 78319586 unclassified probably benign
R0535:Spag5 UTSW 11 78304728 missense probably benign 0.00
R0557:Spag5 UTSW 11 78314211 missense probably damaging 0.99
R0584:Spag5 UTSW 11 78304095 missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78313396 missense probably damaging 1.00
R0723:Spag5 UTSW 11 78319584 unclassified probably benign
R1413:Spag5 UTSW 11 78305317 nonsense probably null
R1680:Spag5 UTSW 11 78320616 missense probably damaging 1.00
R1687:Spag5 UTSW 11 78304929 missense probably benign 0.32
R1696:Spag5 UTSW 11 78321326 missense probably damaging 1.00
R1831:Spag5 UTSW 11 78314256 missense probably benign 0.08
R1866:Spag5 UTSW 11 78304455 missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78304176 missense probably benign 0.01
R4004:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4005:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4222:Spag5 UTSW 11 78304511 missense probably damaging 1.00
R4750:Spag5 UTSW 11 78320052 missense probably benign 0.00
R4771:Spag5 UTSW 11 78304766 missense probably damaging 1.00
R4928:Spag5 UTSW 11 78314373 missense probably damaging 0.97
R5360:Spag5 UTSW 11 78314762 missense probably damaging 0.99
R5366:Spag5 UTSW 11 78320326 splice site probably null
R5618:Spag5 UTSW 11 78304080 missense probably benign 0.00
R5668:Spag5 UTSW 11 78304716 missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78304146 missense probably benign 0.25
R5859:Spag5 UTSW 11 78313534 missense probably benign 0.38
R6564:Spag5 UTSW 11 78315575 missense probably damaging 1.00
R6571:Spag5 UTSW 11 78321269 missense probably damaging 1.00
R6573:Spag5 UTSW 11 78314182 nonsense probably null
R7074:Spag5 UTSW 11 78305042 critical splice donor site probably null
R7332:Spag5 UTSW 11 78313379 nonsense probably null
R8073:Spag5 UTSW 11 78301977 missense probably benign 0.22
R8709:Spag5 UTSW 11 78301912 missense probably benign
R8723:Spag5 UTSW 11 78321389 missense probably damaging 1.00
R8976:Spag5 UTSW 11 78304587 missense probably benign 0.01
R9053:Spag5 UTSW 11 78321749 missense probably benign 0.14
R9142:Spag5 UTSW 11 78301997 missense possibly damaging 0.56
Z1176:Spag5 UTSW 11 78314982 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGTTGTGAGCTAACTTTTCCATC -3'
(R):5'- AGCAAGGACAACAGGTCTCC -3'

Sequencing Primer
(F):5'- CTCGTATGAACAGTTCTTGTAGC -3'
(R):5'- CAGAGACTAGACCCCATGATTGCTG -3'
Posted On 2019-05-15