Incidental Mutation 'R7091:Mta1'
ID 550228
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113061898-113100826 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113100022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 644 (D644G)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]
AlphaFold Q8K4B0
Predicted Effect probably damaging
Transcript: ENSMUST00000009099
AA Change: D656G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: D656G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: D639G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: D639G

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: D644G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: D644G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: D639G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: D639G

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: D644G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: D644G

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113,084,528 (GRCm39) missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113,090,418 (GRCm39) missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113,100,203 (GRCm39) missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113,093,741 (GRCm39) missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113,096,870 (GRCm39) missense probably benign 0.06
R0361:Mta1 UTSW 12 113,096,961 (GRCm39) splice site probably null
R0496:Mta1 UTSW 12 113,094,941 (GRCm39) nonsense probably null
R1774:Mta1 UTSW 12 113,091,659 (GRCm39) missense probably damaging 1.00
R1870:Mta1 UTSW 12 113,091,694 (GRCm39) missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113,099,926 (GRCm39) missense probably damaging 0.97
R2110:Mta1 UTSW 12 113,095,248 (GRCm39) missense probably damaging 1.00
R2111:Mta1 UTSW 12 113,095,248 (GRCm39) missense probably damaging 1.00
R2184:Mta1 UTSW 12 113,093,815 (GRCm39) critical splice donor site probably null
R2274:Mta1 UTSW 12 113,091,770 (GRCm39) missense probably damaging 1.00
R4087:Mta1 UTSW 12 113,075,802 (GRCm39) missense probably damaging 1.00
R4231:Mta1 UTSW 12 113,099,447 (GRCm39) missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113,100,160 (GRCm39) missense probably benign 0.17
R5032:Mta1 UTSW 12 113,097,145 (GRCm39) splice site probably null
R5271:Mta1 UTSW 12 113,095,577 (GRCm39) missense probably damaging 0.99
R5344:Mta1 UTSW 12 113,095,186 (GRCm39) splice site probably benign
R5392:Mta1 UTSW 12 113,096,856 (GRCm39) missense probably benign
R5656:Mta1 UTSW 12 113,086,759 (GRCm39) missense probably damaging 1.00
R5903:Mta1 UTSW 12 113,100,239 (GRCm39) missense probably damaging 1.00
R6168:Mta1 UTSW 12 113,086,739 (GRCm39) missense probably damaging 0.96
R7334:Mta1 UTSW 12 113,090,418 (GRCm39) missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113,095,088 (GRCm39) critical splice donor site probably null
R7889:Mta1 UTSW 12 113,095,308 (GRCm39) missense probably benign 0.02
R8136:Mta1 UTSW 12 113,095,298 (GRCm39) missense probably damaging 1.00
R8176:Mta1 UTSW 12 113,084,456 (GRCm39) missense probably benign 0.00
R8385:Mta1 UTSW 12 113,095,085 (GRCm39) missense probably benign
R8398:Mta1 UTSW 12 113,095,242 (GRCm39) missense possibly damaging 0.83
R9132:Mta1 UTSW 12 113,100,025 (GRCm39) missense probably damaging 1.00
R9159:Mta1 UTSW 12 113,100,025 (GRCm39) missense probably damaging 1.00
R9418:Mta1 UTSW 12 113,094,987 (GRCm39) missense probably damaging 1.00
R9489:Mta1 UTSW 12 113,095,085 (GRCm39) missense probably benign
R9596:Mta1 UTSW 12 113,090,470 (GRCm39) missense probably damaging 0.99
R9682:Mta1 UTSW 12 113,095,384 (GRCm39) critical splice donor site probably null
Z1088:Mta1 UTSW 12 113,096,820 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AAGGTCAGGGTACTGTCTTCC -3'
(R):5'- CATCATTGACTGGTGCAGGTGG -3'

Sequencing Primer
(F):5'- CAGGGTACTGTCTTCCTGTGTC -3'
(R):5'- CGCAGGGCAATGGGTTTG -3'
Posted On 2019-05-15