Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Mta1'

550228

Institutional Source

Beutler Lab

Gene Symbol

Mta1

Ensembl Gene

ENSMUSG00000021144

Gene Name

metastasis associated 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113098278-113137206 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113136402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 644 (D644G)

Ref Sequence

ENSEMBL: ENSMUSP00000105349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]

AlphaFold

Q8K4B0

Predicted Effect

probably damaging
Transcript: ENSMUST00000009099
AA Change: D656G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: D656G

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069690
AA Change: D639G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: D639G

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084882

SMART Domains

Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	4	56	2.08e-12	SMART
low complexity region	104	115	N/A	INTRINSIC
LIM	125	177	6.05e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109723
AA Change: D644G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: D644G

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109726
AA Change: D639G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: D639G

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109727
AA Change: D644G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: D644G

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200380

SMART Domains

Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	1	53	3e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Mta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:Mta1	APN	12	113120908	missense	possibly damaging	0.94
IGL02250:Mta1	APN	12	113126798	missense	possibly damaging	0.59
IGL02391:Mta1	APN	12	113136583	missense	possibly damaging	0.79
IGL02670:Mta1	APN	12	113130121	missense	probably damaging	1.00
PIT4382001:Mta1	UTSW	12	113133250	missense	probably benign	0.06
R0361:Mta1	UTSW	12	113133341	splice site	probably null
R0496:Mta1	UTSW	12	113131321	nonsense	probably null
R1774:Mta1	UTSW	12	113128039	missense	probably damaging	1.00
R1870:Mta1	UTSW	12	113128074	missense	possibly damaging	0.73
R1976:Mta1	UTSW	12	113136306	missense	probably damaging	0.97
R2110:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2111:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2184:Mta1	UTSW	12	113130195	critical splice donor site	probably null
R2274:Mta1	UTSW	12	113128150	missense	probably damaging	1.00
R4087:Mta1	UTSW	12	113112182	missense	probably damaging	1.00
R4231:Mta1	UTSW	12	113135827	missense	possibly damaging	0.95
R4916:Mta1	UTSW	12	113136540	missense	probably benign	0.17
R5032:Mta1	UTSW	12	113133525	splice site	probably null
R5271:Mta1	UTSW	12	113131957	missense	probably damaging	0.99
R5344:Mta1	UTSW	12	113131566	splice site	probably benign
R5392:Mta1	UTSW	12	113133236	missense	probably benign
R5656:Mta1	UTSW	12	113123139	missense	probably damaging	1.00
R5903:Mta1	UTSW	12	113136619	missense	probably damaging	1.00
R6168:Mta1	UTSW	12	113123119	missense	probably damaging	0.96
R7334:Mta1	UTSW	12	113126798	missense	possibly damaging	0.59
R7408:Mta1	UTSW	12	113131468	critical splice donor site	probably null
R7889:Mta1	UTSW	12	113131688	missense	probably benign	0.02
R8136:Mta1	UTSW	12	113131678	missense	probably damaging	1.00
R8176:Mta1	UTSW	12	113120836	missense	probably benign	0.00
R8385:Mta1	UTSW	12	113131465	missense	probably benign
R8398:Mta1	UTSW	12	113131622	missense	possibly damaging	0.83
R9132:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9159:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9418:Mta1	UTSW	12	113131367	missense	probably damaging	1.00
R9489:Mta1	UTSW	12	113131465	missense	probably benign
R9596:Mta1	UTSW	12	113126850	missense	probably damaging	0.99
R9682:Mta1	UTSW	12	113131764	critical splice donor site	probably null
Z1088:Mta1	UTSW	12	113133200	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- AAGGTCAGGGTACTGTCTTCC -3'
(R):5'- CATCATTGACTGGTGCAGGTGG -3'

Sequencing Primer
(F):5'- CAGGGTACTGTCTTCCTGTGTC -3'
(R):5'- CGCAGGGCAATGGGTTTG -3'

Posted On

2019-05-15